Aphonopelma anax

(Chamberlin, 1940) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theraphosidae/Aphonopelma

At a glance

Occurrence records1 113

Data sources8

Biological traits2

DNA specimens59

eDNA detections59

Sources8 archives

Databases and archives Aphonopelma anax's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 113 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

World Spider Trait DBMasaryk University2 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 113 records

Environmental DNA1 datasets · 0 countries59 detections

DNA & barcodingBOLD59 specimens

01Narrative

Aphonopelma anax, commonly known as the Texas tan tarantula, is a species of spider belonging to the family Theraphosidae native to southern Texas and northern Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesShillington 2005

Morphometry1

Body mass10.48 mm

Physiology1

Resting metabolic rate0.001 mm

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphonopelma anax has left across the world's sequence archives.

At a glance

DNA specimens59

BINs2

Marker genes1

eDNA detections59

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P760 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

29Tvariable

74Cvariable

122Tmostly conserved

131Cvariable

140Avariable

149Tvariable

167Amostly conserved

176Avariable

179Gvariable

185Tvariable

191Gvariable

192Avariable

203Gvariable

221Gmostly conserved

242Gvariable

251Gvariable

287Amostly conserved

290Gmostly conserved

302Tvariable

338Tmostly conserved

350Tmostly conserved

410Gvariable

413Gmostly conserved

419Avariable

423Gvariable

449Tmostly conserved

461Gvariable

479Amostly conserved

494Amostly conserved

506Gmostly conserved

509Tmostly conserved

515Amostly conserved

521Tmostly conserved

530Cmostly conserved

560Avariable

563Cvariable

587Tmostly conserved

596Avariable

605Tvariable

614Avariable

650Cmostly conserved

656Tvariable

669Gmostly conserved

677Gmostly conserved

680Avariable

683Gmostly conserved

TTTTGTCGTCATTGACTGATGTAGGGGTTGGAGCTGGTTGAACTATTTATCCTCCTTTGTCTTCTTTTGTTGGCCATTCTGGAGGTGGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes17

BINs2

Most divergent pair4.3%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphonopelma armadasame genus8.6%Aphonopelma moderatumsame genus11.1%Aphonopelma gabelisame genus11.2%Aphonopelma eutylenumsame genus11.3%Aphonopelma iodiussame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 113 records

Wild obs. + sensor1 111

Museum / vouchered2

Range

Area of Occupancy AOO2 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 615≤1 km 143≤10 km 52>10 km 98

908 georeferenced · 203 without coordinates

Open the mapobservation + sensor1 111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	1
	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA59 detections

Where the DNA of Aphonopelma anax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found59

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 59 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphonopelma anax

At a glance

Sources8 archives

Morphometry1

Physiology1

At a glance

Record type1 113 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 2 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 113 records