Aphomia terrenella

Zeller, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Aphomia

At a glance

Occurrence records345

Data sources6

Biological traits0

DNA specimens30

eDNA detections30

Sources6 archives

Databases and archives Aphomia terrenella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility345 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF345 records

Environmental DNA1 datasets · 2 countries30 detections

DNA & barcodingBOLD30 specimens

01Narrative

Aphomia terrenella, the terrenella bee moth, is a moth of the family Pyralidae. It is found in North America from Michigan, Ontario, Quebec and New York south to Georgia. The wingspan is about 25 mm. Adults have brownish-gray forewings with an indistinct blackish streak running from the wing base to the middle of the disc. They are on wing from May to August. The larvae possibly feed on the honeycomb and/or larvae of bees.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphomia terrenella has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections30

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

235Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACCTCTCTTAGGCTTTTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes5

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphomia fulminalissame genus9.0%Pterothrixidia rufellasame family9.9%Arhodia lasiocampariasame order10.0%Casbia calliormasame order10.3%Endotricha erythralissame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type345 records

Wild obs. + sensor284

Museum / vouchered61

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 155≤1 km 53≤10 km 10>10 km 23

241 georeferenced · 43 without coordinates

Open the mapobservation + sensor284

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 3≤10 km 18>10 km 11

32 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	15
Mississippi State, US	12
CUlocation not on record	8
Philadelphia, US	5
Georgia Museum of Natural Historylocation not on record	5
Decorah, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
New Haven, US	2
SOVTlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1
St. Paul, US	1
Mississippi Entomological Museumlocation not on record	1

12 institutions · 58 of 61 vouchered records shown · 3 without an institution code

09Environmental DNA30 detections

Where the DNA of Aphomia terrenella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map2 countries0

Bord de Lac mixteerabliere (erable, chene noyer)ForestBord sablonneux du lac Bellemare, boise borealerabliere (erable, chene, noyer)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 18.7–24.9

Seasonal swing summer↔winter25.7 °C

Max temp (day)25.5 °C 23.5–29.1

Min temp (night)16.2 °C 13.7–21.1

Precipitation106 mm/mo 85.6–141

Air humidity58.8 % 57.4–61.6

Moisture balance-35.5 mm/mo -64.8–-14.5

Vapour deficit1,022 Pa 851–1,320

Wind speed3.00 m/s 1.70–5.10

Cloud cover39.1 % 31.8–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)