Arhodia lasiocamparia

Guenée, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Arhodia

At a glance

Occurrence records1 625

Data sources7

Biological traits0

DNA specimens363

eDNA detections376

Sources7 archives

Databases and archives Arhodia lasiocamparia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 625 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI376 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics363 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 625 records

Environmental DNA1 datasets · 2 countries376 detections

DNA & barcodingBOLD363 specimens

01Narrative

Arhodia is a monotypic moth genus in the family Geometridae. Its only species, Arhodia lasiocamparia, the pink arhodia, is found in mainland Australia and Tasmania. Both the genus and species were first described by Achille Guenée in 1857. The wingspan is about 60 mm for males and 70 mm for females. The moth flies from October to January. The larvae feed on Eucalyptus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding363 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arhodia lasiocamparia has left across the world's sequence archives.

At a glance

DNA specimens363

BINs11

Marker genes2

eDNA detections376

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus333 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 80 variable positions, in barcode order

31Tvariable

59Tmostly conserved

67Amostly conserved

82Tmostly conserved

85Avariable

94Amostly conserved

100Amostly conserved

106Tmostly conserved

118Tmostly conserved

121Tmostly conserved

127Tmostly conserved

130Tmostly conserved

133Avariable

157Tvariable

169Tmostly conserved

178Tvariable

193Tmostly conserved

197Tmostly conserved

200Gmostly conserved

202Amostly conserved

206Tmostly conserved

217Amostly conserved

220Cvariable

235Cmostly conserved

241Amostly conserved

271Amostly conserved

277Tmostly conserved

295Avariable

304Tmostly conserved

316Amostly conserved

322Tvariable

328Avariable

337Tvariable

340Tmostly conserved

343Tvariable

346Tmostly conserved

347Tmostly conserved

352Tmostly conserved

364Tmostly conserved

367Tmostly conserved

368Gmostly conserved

376Tvariable

391Tvariable

394Tmostly conserved

400Tvariable

401Cmostly conserved

403Tmostly conserved

415Tmostly conserved

418Tmostly conserved

433Amostly conserved

463Tmostly conserved

478Tmostly conserved

484Tvariable

499Tmostly conserved

500Tmostly conserved

508Avariable

517Amostly conserved

532Tmostly conserved

533Tmostly conserved

539Tmostly conserved

541Amostly conserved

542Tmostly conserved

547Tvariable

553Tvariable

556Tvariable

562Amostly conserved

568Tmostly conserved

574Tmostly conserved

583Amostly conserved

595Tmostly conserved

604Tmostly conserved

610Tmostly conserved

613Tmostly conserved

616Tmostly conserved

619Amostly conserved

622Amostly conserved

628Amostly conserved

640Cvariable

646Tmostly conserved

652Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAATTGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 34 commonest of 74 variants.

Diversity (π)4.1%

Haplotypes74

BINs11

Most divergent pair6.7%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neohipparchus vallatasame family5.0%Phallaria ophiusariasame family5.2%Ennomos quercinariasame family5.3%Archichlora devolutasame family5.5%Synopsidia phasidariasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 625 records

Wild obs. + sensor1 408

Museum / vouchered217

Range

Area of Occupancy AOO2 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 576≤1 km 329≤10 km 79>10 km 69

1 053 georeferenced · 355 without coordinates

Open the mapobservation + sensor1 408

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 26≤10 km 15

41 georeferenced · 176 without coordinates

Open the institutions mapphysical evidence217

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	61
Tasmanian Museum & Art Gallerylocation not on record	17
Australian National Insect Collectionlocation not on record	9
Sydney, AU	9
Tallinn, EE	4
Research Collection of Egbert Friedrichlocation not on record	2
ZSM Collection of Manfred Sommererlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
New Haven, US	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
ZSMlocation not on record	1
Australian National Fish Collectionlocation not on record	1
Gujarat State Biotechnology Missionlocation not on record	1

13 institutions · 111 of 217 vouchered records shown · 106 without an institution code

09Environmental DNA376 detections

Where the DNA of Arhodia lasiocamparia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found376

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 376 detections have coordinates

Open the map2 countries0

Grassland3. Shrubland|3.8. Mediterranean-type Shrubby…Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 15.6–24.8

Seasonal swing summer↔winter10.3 °C

Max temp (day)24.4 °C 20.1–30.7

Min temp (night)16.7 °C 10.0–22.0

Precipitation80.3 mm/mo 22.1–167

Air humidity58.1 % 47.1–62.0

Moisture balance-63.5 mm/mo

Vapour deficit1,033 Pa 755–1,554

Wind speed3.90 m/s

Cloud cover25.2 % 14.0–32.0

CHELSA 1981–2010, ~9 km grid, at location & month of 373 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arhodia lasiocamparia

At a glance

Sources7 archives

At a glance

Record type1 625 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 625 records