Aphnaeus orcas

(Drury, 1782) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Aphnaeus

At a glance

Occurrence records107

Data sources7

Biological traits0

DNA specimens37

eDNA detections30

Sources7 archives

Databases and archives Aphnaeus orcas's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF107 records

Environmental DNA1 datasets · 10 countries30 detections

DNA & barcodingBOLD37 specimens

01Narrative

Aphnaeus orcas, the common highflier or common silver spot, is a butterfly in the family Lycaenidae. It is found in Senegal, the Gambia, Guinea-Bissau, Guinea, Sierra Leone, Liberia, Ivory Coast, Ghana, Nigeria (south and the Cross River loop), Cameroon, Gabon, the Republic of the Congo, Angola, the Central African Republic, the Democratic Republic of the Congo (Mongala, Uele, Tshopo, Tshuapa, Equateur, Sankuru and Lualaba), Uganda, western and south-western Kenya, Tanzania and Zambia. The habitat consists of forests. Both sexes feed from flowers and males mud-puddle. The larvae feed on Alchornea cordifolia, Albizia, Allophylus, Blighia, Loranthus, Macaranga, Olea, Paullinia, Rhus, Scolopia, Scutia and Uncaria species. They are attended by ants of the family Formicidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphnaeus orcas has left across the world's sequence archives.

At a glance

DNA specimens37

BINs4

Marker genes1

eDNA detections30

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

22Tmostly conserved

58Amostly conserved

73Amostly conserved

85Tmostly conserved

88Amostly conserved

130Cmostly conserved

136Cmostly conserved

178Cvariable

206Tvariable

212Cmostly conserved

217Cmostly conserved

238Amostly conserved

313Tmostly conserved

346Amostly conserved

355Avariable

358Tvariable

403Amostly conserved

416Amostly conserved

463Tmostly conserved

466Gvariable

477Avariable

484Tvariable

550Amostly conserved

562Tmostly conserved

586Tmostly conserved

640Tvariable

646Tmostly conserved

653Tvariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTCTAAGAGTATTAATTCGAATAGAATTAGGAACTCCTGGAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes16

BINs4

Most divergent pair3.0%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphnaeus argyrocyclussame genus5.8%Aphnaeus adamsisame genus7.3%Aphnaeus charbonelisame genus7.4%Aphnaeus jacksonisame genus7.5%Aphnaeus erikssonisame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type107 records

Wild obs. + sensor39

Museum / vouchered54

Other14

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 16≤1 km 11≤10 km 4>10 km 2

33 georeferenced · 6 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	34
African Butterfly Research Institutelocation not on record	7
New Haven, US	3
Cambridge, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

5 institutions · 46 of 54 vouchered records shown · 8 without an institution code

09Environmental DNA30 detections

Where the DNA of Aphnaeus orcas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 16.8–28.9

Seasonal swing summer↔winter3.60 °C

Max temp (day)28.7 °C 22.4–35.0

Min temp (night)20.4 °C 11.7–23.8

Precipitation157 mm/mo 44.1–260

Air humidity62.9 % 51.0–68.0

Moisture balance22.8 mm/mo -118–128

Vapour deficit975 Pa 878–1,945

Wind speed1.80 m/s 1.00–2.80

Cloud cover27.1 % 16.4–60.1

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)