Aphnaeus argyrocyclus

Holland, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Aphnaeus

At a glance

Occurrence records12

Data sources8

Biological traits0

DNA specimens9

eDNA detections8

Sources8 archives

Databases and archives Aphnaeus argyrocyclus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aphnaeus argyrocyclus, the rare silver spot, is a butterfly in the family Lycaenidae. It is found in Ivory Coast, Ghana, Nigeria (the eastern part of the country and the Cross River loop), Cameroon, Gabon, the Republic of the Congo, the Central African Republic, the Democratic Republic of the Congo (Équateur, Tshopo and Maniema), Uganda and north-western Tanzania. The habitat consists of forests. The larvae feed on Alchornea cordifolia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphnaeus argyrocyclus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.00%

Haplotypes2

BIN1

Most divergent pair0.91%

Where individuals differ — all 18 variable positions, in barcode order

39Tmostly conserved

74Cmostly conserved

76Gmostly conserved

79Avariable

103Cvariable

136Tmostly conserved

217Cmostly conserved

235Cmostly conserved

238Amostly conserved

241Amostly conserved

292Cmostly conserved

415Gvariable

433Amostly conserved

463Cmostly conserved

508Tmostly conserved

550Gvariable

565Tvariable

646Cvariable

AACTTTATACTTTATTTTTGGTATCTGAGCTGGAATAGTAGGAACATCCCTAAGAGTATTAATTCGAATAGAACTGGGAACTCCTGGAGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphnaeus orcassame genus5.8%Aphnaeus adamsisame genus9.1%Aphnaeus erikssonisame genus9.3%Aloeides caledonisame family9.3%Aphnaeus charbonelisame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type12 records

Wild obs. + sensor7

Museum / vouchered5

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 3≤1 km 2≤10 km 1>10 km 1

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	2
New Haven, US	1

2 institutions · 3 of 5 vouchered records shown · 2 without an institution code

09Environmental DNA8 detections

Where the DNA of Aphnaeus argyrocyclus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 22.4–26.8

Seasonal swing summer↔winter4.00 °C

Max temp (day)29.1 °C 26.3–32.1

Min temp (night)21.0 °C 19.8–23.2

Precipitation178 mm/mo 85.6–286

Air humidity65.2 % 56.1–69.2

Moisture balance62.3 mm/mo -71.3–169

Vapour deficit1,091 Pa 826–1,547

Wind speed1.50 m/s 1.10–2.00

Cloud cover35.5 % 21.9–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)