Aphis rubicola

Oestlund, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records286

Data sources5

Biological traits0

DNA specimens274

eDNA detections273

Sources5 archives

Databases and archives Aphis rubicola's data was compiled from.

GBIFGlobal Biodiversity Information Facility286 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI273 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics274 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF286 records

Environmental DNA1 datasets · 2 countries273 detections

DNA & barcodingBOLD274 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding274 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis rubicola has left across the world's sequence archives.

At a glance

DNA specimens274

BINs1

Marker genes1

eDNA detections273

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus215 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

7Amostly conserved

9Amostly conserved

10Tmostly conserved

14Tmostly conserved

15Tmostly conserved

17Tmostly conserved

20Gmostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

36Tmostly conserved

38Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Tmostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

50Cmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

59Tmostly conserved

60Tmostly conserved

62Amostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

71Gmostly conserved

72Amostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

343Tmostly conserved

481Amostly conserved

AACTTTATATTTTTTATTTGGAATTTGATCAGGTATAATTGGATCTTCACTAAGAATTTTAATTCGATTAGAATTAAGTCAAATTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes7

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis rubifoliisame genus3.1%Aphis idaeisame genus3.8%Aphis forbesisame genus4.4%Aphis nasturtiisame genus4.7%Aphis umbrellasame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type286 records

Museum / vouchered286

Range

Area of Occupancy AOO268 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 1≤1 km 1≤10 km 49>10 km 29

80 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence286

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	73
University Park, US	41
South Kensington, GB	29
WIlocation not on record	9
Champaign, US	8
Centre for Biodiversity Genomicslocation not on record	7
Essig Museum of Entomologylocation not on record	5
Biodiversity Institute of Ontariolocation not on record	1

8 institutions · 173 of 286 vouchered records shown · 113 without an institution code

09Environmental DNA273 detections

Where the DNA of Aphis rubicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found273

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 273 detections have coordinates

Open the map2 countries0

4. Native GrasslandWetlandGrasslandMixed habitatForest5. Wetlands (inland)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 13.2–18.2

Seasonal swing summer↔winter24.9 °C

Max temp (day)20.2 °C 17.9–23.5

Min temp (night)10.4 °C 7.70–14.2

Precipitation76.6 mm/mo 42.3–116

Air humidity56.6 % 55.9–59.9

Moisture balance-62.3 mm/mo -71.4–7.60

Vapour deficit733 Pa 592–888

Wind speed2.70 m/s 1.40–4.30

Cloud cover40.8 % 36.7–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 241 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)