Aphis forbesi

Weed, 1889 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records101

Data sources6

Biological traits0

DNA specimens40

eDNA detections41

Sources6 archives

Databases and archives Aphis forbesi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF101 records

Environmental DNA1 datasets · 7 countries41 detections

DNA & barcodingBOLD40 specimens

01Narrative

Aphis forbesi é uma espécie de afídio, da família Aphididae, vulgarmente designado como piolho-do-morangueiro, afídio-do-morangueiro ou pulgão-do-morangueiro, já que é uma espécie monófaga. Os adultos ápteros, de cor verde-escura, medem de 1,8 a 2,2 mm de comprimento, têm forma globosa e sinfúnculos que medem cerca de um sexto do comprimento do corpo. - As fêmeas fundatrizes nascem em Março, a partir de ovos depositados nos pecíolos da folhas. As virgo alatae aparecem no final da Primavera e colonizam novos morangueiros, deixando-os pegajosos e cobertos de enxúvia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis forbesi has left across the world's sequence archives.

At a glance

DNA specimens40

BINs2

Marker genes1

eDNA detections41

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

7Amostly conserved

14Tmostly conserved

22Tmostly conserved

100Cmostly conserved

110Tmostly conserved

190Avariable

505Tmostly conserved

613Tmostly conserved

622Tmostly conserved

625Tmostly conserved

628Amostly conserved

634Tmostly conserved

637Amostly conserved

658Cmostly conserved

AACTTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGATCCTCACTTAGAATTTTAATTCGATTAGAATTAAGTCAAATTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes4

BINs2

Most divergent pair0.76%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis clematidissame genus3.7%Aphis ichigosame genus4.3%Aphis rubicolasame genus4.4%Aphis umbrellasame genus4.7%Aphis nasturtiisame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type101 records

Museum / vouchered101

Range

Area of Occupancy AOO160 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 3≤1 km 3≤10 km 10>10 km 4

20 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence101

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
Copenhagen, DK	16
WIlocation not on record	12
Essig Museum of Entomologylocation not on record	10
Champaign, US	9
East Lansing, US	8
South Kensington, GB	2
Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 74 of 101 vouchered records shown · 27 without an institution code

09Environmental DNA41 detections

Where the DNA of Aphis forbesi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map7 countries0

UrbanForest1. Forest & Woodland|1.1. Boreal ForestWetlandGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 10.8–18.8

Seasonal swing summer↔winter25.4 °C

Max temp (day)18.8 °C 16.4–23.1

Min temp (night)8.90 °C 5.20–14.8

Precipitation86.7 mm/mo 65.0–145

Air humidity55.9 % 55.3–59.5

Moisture balance-32.7 mm/mo -62.8–3.30

Vapour deficit683 Pa 575–896

Wind speed2.80 m/s 2.40–4.10

Cloud cover38.9 % 32.5–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)