Aphis pomi

Vallot, 1802 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records314

Data sources5

Biological traits0

DNA specimens206

eDNA detections42

Sources5 archives

Databases and archives Aphis pomi's data was compiled from.

GBIFGlobal Biodiversity Information Facility314 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics206 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF314 records

Environmental DNA1 datasets · 12 countries42 detections

DNA & barcodingBOLD206 specimens

Genome at a glanceGoaT479 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding206 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis pomi has left across the world's sequence archives.

At a glance

DNA specimens206

BINs1

Marker genes1

eDNA detections42

Countries23

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus202 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

49Tmostly conserved

74Tmostly conserved

85Tmostly conserved

100Cmostly conserved

202Cmostly conserved

217Amostly conserved

220Cmostly conserved

235Cmostly conserved

271Gmostly conserved

274Tmostly conserved

278Cmostly conserved

301Tmostly conserved

334Amostly conserved

346Cmostly conserved

364Cmostly conserved

394Tmostly conserved

403Tmostly conserved

415Tmostly conserved

AACTTTATATTTTTTATTTGGTATTTGATCAGGAATAATTGGATCTTCTCTTAGAATTTTAATTCGATTAGAATTAAGTCAAATTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.65%

Haplotypes6

BIN1

Most divergent pair5.3%

N.AmericaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis spiraecolasame genus4.9%Aphis maculataesame genus5.8%Aphis celastriisame genus5.9%Aphis fabaesame genus6.1%Aphis viburnisame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Aphis pomi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size479 220 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphis pomi0.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome records8–82n range8median8mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 82×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

08Occurrence & distribution

Record type314 records

Wild obs. + sensor125

Museum / vouchered189

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 20≤1 km 14≤10 km 30

64 georeferenced · 61 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 189 records without

Open the institutions mapphysical evidence189

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Natural History Museum, Londonlocation not on record	1

2 institutions · 2 of 189 vouchered records shown · 147 without an institution code

09Environmental DNA42 detections

Where the DNA of Aphis pomi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 6.50–10.4

Seasonal swing summer↔winter21.7 °C

Max temp (day)11.9 °C 9.70–15.7

Min temp (night)3.80 °C 3.00–6.70

Precipitation53.3 mm/mo 13.8–75.2

Air humidity63.0 % 45.7–65.5

Moisture balance-9.50 mm/mo -95.2–12.3

Vapour deficit471 Pa 415–827

Wind speed4.10 m/s 2.80–4.60

Cloud cover48.4 % 24.1–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)