Aphidius rosae

Haliday, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aphidius

At a glance

Occurrence records55

Data sources5

Biological traits0

DNA specimens30

eDNA detections60

Sources5 archives

Databases and archives Aphidius rosae's data was compiled from.

GBIFGlobal Biodiversity Information Facility55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF55 records

Environmental DNA4 datasets · 8 countries60 detections

DNA & barcodingBOLD30 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphidius rosae has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes2

eDNA detections60

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

86Tmostly conserved

131Tvariable

167Tmostly conserved

170Tmostly conserved

182Tmostly conserved

215Tmostly conserved

233Tmostly conserved

362Amostly conserved

416Tmostly conserved

471Tmostly conserved

477Gmostly conserved

530Tmostly conserved

563Gmostly conserved

TTTTATATTTTATTTTTGGTATATGATCTGGTATATTAGGATTATCAATAAGATTATTAATTCGTATAGAATTAAGAATTACTGGTAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes5

BIN1

Most divergent pair2.1%

OceaniaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphidius arvensissame genus5.7%Aphidius funebrissame genus6.1%Aphidius leclantisame genus6.2%Aphidius ervisame genus6.2%Aphidius microlophiisame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type55 records

Wild obs. + sensor26

Museum / vouchered29

Origin

Native5

Introduced1

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 4≤1 km 16≤10 km 3>10 km 3

26 georeferenced

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2≤10 km 2

5 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UVEG-ENVlocation not on record	13
I.I. Schmalhausen Institute of Zoologylocation not on record	3
Stockholm, SE	2
Helsinki, FI	2
UAclocation not on record	1

5 institutions · 21 of 29 vouchered records shown · 8 without an institution code

09Environmental DNA60 detections

Where the DNA of Aphidius rosae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys4

Countries8

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map8 countries0

14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 13.2–16.0

Seasonal swing summer↔winter15.6 °C

Max temp (day)17.9 °C 15.7–21.1

Min temp (night)10.8 °C 9.00–13.0

Precipitation65.9 mm/mo 52.9–82.3

Air humidity60.6 % 57.4–61.8

Moisture balance-51.1 mm/mo -73.0–-7.90

Vapour deficit649 Pa 589–766

Wind speed3.70 m/s 2.20–5.20

Cloud cover41.1 % 17.0–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)