Aphidius ervi

Haliday, 1834 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aphidius

At a glance

Occurrence records850

Data sources8

Biological traits0

DNA specimens2 309

eDNA detections3 237

Sources8 archives

Databases and archives Aphidius ervi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility850 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 237 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 309 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF850 records

Environmental DNA5 datasets · 30 countries3 237 detections

DNA & barcodingBOLD2 309 specimens

Genome at a glanceGoaT · NCBI137 Mbp

01Narrative

Aphidius ervi est une espèce d'hyménoptères de la sous-famille des Aphidiinae de petite taille.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 309 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphidius ervi has left across the world's sequence archives.

At a glance

DNA specimens2 309

BINs5

Marker genes2

eDNA detections3 237

Countries31

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus2 159 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

22Amostly conserved

41Cmostly conserved

151Tmostly conserved

340Cmostly conserved

344Tmostly conserved

412Tmostly conserved

TTTATATTTTATTTTTGGTATATGATCTGGAGTATTAGGTCTATCTATAAGATTATTAATTCGTATAGAATTAAGAATTACTGGTAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 36 commonest of 88 variants.

Diversity (π)0.56%

Haplotypes88

BINs5

Most divergent pair10.3%

N.AmericaS.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphidius rhopalosiphisame genus3.0%Aphidius urticaesame genus3.2%Aphidius tarsalissame genus3.3%Aphidius matricariaesame genus3.5%Aphidius gifuensissame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphidius ervi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size136 920 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aphidius ervi0.14 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness89.7% BUSCO

08Occurrence & distribution

Record type850 records

Wild obs. + sensor149

Museum / vouchered701

Origin

Native37

Introduced19

Range

Area of Occupancy AOO1 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 4≤1 km 36≤10 km 101

141 georeferenced · 8 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 54≤1 km 7≤10 km 17>10 km 1

79 georeferenced · 622 without coordinates

Open the institutions mapphysical evidence701

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	159
UVEG-ENVlocation not on record	72
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	51
Edmonton, CA	27
DPIlocation not on record	19
CIBIOlocation not on record	18
UAclocation not on record	16
I.I. Schmalhausen Institute of Zoologylocation not on record	14
NTNU-VMlocation not on record	9
US	6
Bavarian State Collection of Zoologylocation not on record	5
ULLlocation not on record	4
DOI/FWS, Kenai National Wildlife Refugelocation not on record	3
Biodiversity Institute of Ontariolocation not on record	3
MWLRlocation not on record	3
Eszterhazy Karoly University of Applied Scienceslocation not on record	2
Helsinki, FI	2
University of Belgrade-Faculty of Biologylocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Natural History Museum, Londonlocation not on record	2
South Kensington, GB	2
MZLUlocation not on record	2
Washington, US	1
UKY-HIClocation not on record	1
OSUClocation not on record	1
SLU Artdatabankenlocation not on record	1
neflocation not on record	1
Landcare Research, New Zealand Arthropod Collectionlocation not on record	1

28 institutions · 429 of 701 vouchered records shown · 270 without an institution code

09Environmental DNA3 237 detections

Where the DNA of Aphidius ervi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3 237

Studies independent surveys5

Countries30

Verifiable raw sequence linked503

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 237 detections have coordinates

Open the map30 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…1. Forest|1.2 Subarctic ForestTemperate mixed forest1.1 Boreal Forest3. Shrubland|3.8. Shrubland - Mediterranean-…14. Artificial - Terrestrial | 14.4 Rural Ga…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 10.9–20.6

Seasonal swing summer↔winter17.3 °C

Max temp (day)21.1 °C 14.6–28.1

Min temp (night)10.9 °C 6.00–13.2

Precipitation35.9 mm/mo 5.30–94.9

Air humidity56.0 % 44.2–61.8

Moisture balance-88.5 mm/mo -178–-1.10

Vapour deficit775 Pa 522–1,339

Wind speed3.10 m/s 1.70–4.50

Cloud cover36.8 % 25.1–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 053 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)