Aphidius matricariae

Haliday, 1834 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aphidius

At a glance

Occurrence records137

Data sources6

Biological traits0

DNA specimens86

eDNA detections5

Sources6 archives

Databases and archives Aphidius matricariae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics86 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD86 specimens

01Narrative

Aphidius matricariae est une espèce de guêpe parasitoïde de la famille des Braconidés.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding86 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphidius matricariae has left across the world's sequence archives.

At a glance

DNA specimens86

BINs3

Marker genes2

eDNA detections5

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus82 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

2Tmostly conserved

8Gmostly conserved

47Gmostly conserved

60Amostly conserved

68Cvariable

72Tvariable

101Tmostly conserved

107Gmostly conserved

143Tmostly conserved

164Amostly conserved

197Amostly conserved

200Tmostly conserved

215Tmostly conserved

257Tmostly conserved

282Cvariable

305Amostly conserved

317Tmostly conserved

338Amostly conserved

347Cmostly conserved

350Amostly conserved

353Cvariable

355Tmostly conserved

389Gmostly conserved

395Tmostly conserved

416Cmostly conserved

431Tmostly conserved

459Amostly conserved

485Amostly conserved

509Tvariable

515Gmostly conserved

539Amostly conserved

563Gmostly conserved

608Tmostly conserved

611Gmostly conserved

617Tmostly conserved

GTATATGGTCTGGAGTATTAGGTTTATCTATAAGATTATTAATTCGGATAGAATTAAGAATTACTGGCAGATTAATTGGTAATGATCAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes14

BINs3

Most divergent pair5.9%

AsiaEuropeOtherN.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphidius rhopalosiphisame genus1.6%Aphidius tarsalissame genus2.3%Aphidius sonchisame genus2.6%Aphidius gifuensissame genus2.7%Aphidius smithisame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type137 records

Wild obs. + sensor39

Museum / vouchered98

Origin

Native25

Introduced3

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1≤1 km 30>10 km 5

36 georeferenced · 3 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 3≤1 km 2≤10 km 2

7 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence98

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UVEG-ENVlocation not on record	51
CIBIOlocation not on record	23
I.I. Schmalhausen Institute of Zoologylocation not on record	3
UAclocation not on record	3
Helsinki, FI	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Landcare Research, New Zealand Arthropod Collectionlocation not on record	1

7 institutions · 85 of 98 vouchered records shown · 11 without an institution code

09Environmental DNA5 detections

Where the DNA of Aphidius matricariae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 11.7–20.9

Seasonal swing summer↔winter20.2 °C

Max temp (day)20.7 °C 15.1–26.3

Min temp (night)10.4 °C 7.60–13.2

Precipitation29.9 mm/mo 10.4–49.5

Air humidity51.5 % 42.2–60.9

Moisture balance-68.9 mm/mo -113–-24.7

Vapour deficit1,220 Pa 644–1,796

Wind speed3.20 m/s 2.60–3.90

Cloud cover33.2 % 24.0–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)