Aphidius avenae

Haliday, 1834 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aphidius

At a glance

Occurrence records205

Data sources6

Biological traits0

DNA specimens94

eDNA detections188

Sources6 archives

Databases and archives Aphidius avenae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility205 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI188 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics94 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF205 records

Environmental DNA2 datasets · 7 countries188 detections

DNA & barcodingBOLD94 specimens

01Narrative

Aphidius avenae est une espèce d'insectes hyménoptères de la famille des Braconidae, de la sous-famille des Aphidiinae et mesurant entre 3 et 5 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding94 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphidius avenae has left across the world's sequence archives.

At a glance

DNA specimens94

BINs7

Marker genes2

eDNA detections188

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus79 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

1Amostly conserved

3Tmostly conserved

5Tmostly conserved

6Amostly conserved

8Amostly conserved

10Tmostly conserved

13Amostly conserved

16Tmostly conserved

17Tmostly conserved

19Gmostly conserved

20Gmostly conserved

21Tmostly conserved

22Amostly conserved

23Tmostly conserved

24Amostly conserved

26Gmostly conserved

28Tmostly conserved

29Cmostly conserved

31Gmostly conserved

32Gmostly conserved

34Amostly conserved

38Tmostly conserved

39Tmostly conserved

40Gmostly conserved

41Gmostly conserved

42Gmostly conserved

61Amostly conserved

80Tmostly conserved

171Tvariable

183Tmostly conserved

219Cvariable

225Cmostly conserved

228Amostly conserved

255Gmostly conserved

276Tmostly conserved

297Gmostly conserved

321Gmostly conserved

339Cmostly conserved

342Tmostly conserved

354Amostly conserved

358Cmostly conserved

363Gmostly conserved

367Amostly conserved

369Amostly conserved

390Tmostly conserved

408Gmostly conserved

435Gmostly conserved

510Amostly conserved

532Tmostly conserved

577Cmostly conserved

ATTTTATATTTTATTTTTGGTATATGATCAGGAATAGTTGGGTTATCAATAAGATTAATTATTCGAATAGAATTAAGAATTACTGGTACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes10

BINs6

Most divergent pair2.9%

EuropeAsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphidius viaticussame genus7.6%Aphidius sonchisame genus7.7%Aphidius ervisame genus8.2%Aphidius rhopalosiphisame genus8.5%Aphidius microlophiisame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type205 records

Wild obs. + sensor142

Museum / vouchered62

Other1

Origin

Native6

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 9≤1 km 7≤10 km 125

141 georeferenced · 1 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 9≤1 km 2≤10 km 4

15 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	28
Edmonton, CA	8
I.I. Schmalhausen Institute of Zoologylocation not on record	6
Bavarian State Collection of Zoologylocation not on record	3
Copenhagen, DK	3
Stockholm, SE	2
Helsinki, FI	2
NTNU-VMlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
MZLUlocation not on record	1
University of Belgrade-Faculty of Biologylocation not on record	1
NCMGlocation not on record	1

12 institutions · 57 of 62 vouchered records shown · 5 without an institution code

09Environmental DNA188 detections

Where the DNA of Aphidius avenae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found188

Studies independent surveys2

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 188 detections have coordinates

Open the map7 countries0

Garden/ decidous trees/ meadowMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 9.50–15.0

Seasonal swing summer↔winter15.9 °C

Max temp (day)17.2 °C 13.2–18.7

Min temp (night)10.9 °C 6.10–12.9

Precipitation67.7 mm/mo 60.7–98.0

Air humidity60.9 % 59.9–64.0

Moisture balance-52.0 mm/mo -69.1–136

Vapour deficit642 Pa 456–677

Wind speed4.30 m/s 3.60–6.40

Cloud cover43.6 % 38.3–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 161 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)