Apheloria virginiensis

Drury, 1770 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Diplopoda/Polydesmida/Xystodesmidae/Apheloria

At a glance

Occurrence records5 617

Data sources7

Biological traits0

DNA specimens15

eDNA detections17

Sources7 archives

Databases and archives Apheloria virginiensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility5 617 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 617 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD15 specimens

01Narrative

Apheloria virginiensis, the Kentucky flat millipede, is a large North American millipede. It is reported to secrete cyanide compounds as a defense. It is recommended that one wash hands after handling this organism as the toxic compounds it secretes are poisonous and can cause extreme irritation if rubbed in the eyes. Apheloria virginiensis serves as a host to the parasitic fungus Arthrophaga myriapodina, which causes infected individuals to climb to an elevated spot before death.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apheloria virginiensis has left across the world's sequence archives.

At a glance

DNA specimens15

BINs5

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes2

BINs5

Most divergent pair0.32%

Where individuals differ — all 65 variable positions, in barcode order

39Cmostly conserved

42Tmostly conserved

66Tmostly conserved

75Gmostly conserved

78Gmostly conserved

84Cmostly conserved

87Tmostly conserved

99Tmostly conserved

120Gmostly conserved

129Tmostly conserved

135Tmostly conserved

144Tmostly conserved

147Amostly conserved

180Cmostly conserved

198Amostly conserved

222Gmostly conserved

225Cmostly conserved

234Cmostly conserved

237Tmostly conserved

265Tmostly conserved

270Gmostly conserved

273Cmostly conserved

282Cmostly conserved

284Tmostly conserved

285Gmostly conserved

288Gmostly conserved

289Tmostly conserved

321Tmostly conserved

324Tmostly conserved

330Gmostly conserved

336Tmostly conserved

342Cmostly conserved

345Tmostly conserved

351Tmostly conserved

366Cmostly conserved

372Cmostly conserved

384Cmostly conserved

385Tmostly conserved

406Tmostly conserved

416Cvariable

453Tmostly conserved

456Amostly conserved

471Tmostly conserved

474Tmostly conserved

477Tmostly conserved

495Gmostly conserved

498Cmostly conserved

501Amostly conserved

513Tmostly conserved

531Gmostly conserved

534Amostly conserved

538Cmostly conserved

540Gmostly conserved

541Tmostly conserved

543Amostly conserved

549Amostly conserved

552Tmostly conserved

561Tmostly conserved

567Amostly conserved

573Tmostly conserved

576Gmostly conserved

600Cvariable

615Tmostly conserved

618Gmostly conserved

621Tvariable

ACTATGTATTTGGTTTTTGGGGCTTGGGCTGGGATTGTCGGTTCTGCTTTAAGAAGAATGATTCGTTTGGAGTTGGGGCACTCCGGTAGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rudiloria trimaculatasame family4.9%Deltotaria brimleiisame family9.1%Sigmoria latiorsame family9.6%Appalachioria separandasame family10.0%Appalachioria eutypasame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 617 records

Wild obs. + sensor5 550

Museum / vouchered67

Range

Area of Occupancy AOO13 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 3 141≤1 km 787≤10 km 423>10 km 360

4 711 georeferenced · 839 without coordinates

Open the mapobservation + sensor5 550

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 17≤1 km 4≤10 km 1

22 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blacksburg, US	45
Chicago, US	6
McGill Universitylocation not on record	4
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Virginia Museum of Natural Historylocation not on record	1
Washington, US	1

7 institutions · 60 of 67 vouchered records shown · 7 without an institution code

09Environmental DNA17 detections

Where the DNA of Apheloria virginiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 11.9–13.7

Seasonal swing summer↔winter28.8 °C

Max temp (day)17.6 °C 17.1–19.1

Min temp (night)8.90 °C 7.20–9.60

Precipitation88.2 mm/mo 82.3–99.8

Air humidity56.9 % 56.9–58.9

Moisture balance-29.7 mm/mo -29.7–2.60

Vapour deficit643 Pa 641–716

Wind speed2.90 m/s 2.90–4.10

Cloud cover46.5 % 41.7–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apheloria virginiensis

At a glance

Sources7 archives

At a glance

Record type5 617 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 617 records