Appalachioria separanda

(Chamberlin, 1947) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Diplopoda/Polydesmida/Xystodesmidae/Appalachioria

At a glance

Occurrence records26

Data sources5

Biological traits0

DNA specimens12

eDNA detections6

Sources5 archives

Databases and archives Appalachioria separanda's data was compiled from.

GBIFGlobal Biodiversity Information Facility26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF26 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD12 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Appalachioria separanda has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P510 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

2Cmostly conserved

8Avariable

11Tmostly conserved

14Amostly conserved

20Gmostly conserved

47Amostly conserved

50Gmostly conserved

53Gvariable

65Gmostly conserved

95Amostly conserved

101Tmostly conserved

122Gvariable

125Cvariable

131Amostly conserved

137Gvariable

140Tmostly conserved

143Tvariable

146Cmostly conserved

155Cmostly conserved

158Tmostly conserved

161Amostly conserved

171Cmostly conserved

173Tmostly conserved

182Gmostly conserved

183Tvariable

185Gmostly conserved

188Avariable

191Avariable

194Tmostly conserved

206Gvariable

207Tmostly conserved

209Amostly conserved

224Amostly conserved

230Avariable

232Gmostly conserved

236Tmostly conserved

242Tmostly conserved

254Amostly conserved

266Gmostly conserved

267Cvariable

287Cvariable

290Gvariable

293Cmostly conserved

296Avariable

305Tmostly conserved

326Cvariable

327Cvariable

329Gvariable

338Gmostly conserved

341Tmostly conserved

350Avariable

353Gmostly conserved

356Tmostly conserved

362Cmostly conserved

374Gvariable

377Gmostly conserved

389Amostly conserved

398Tmostly conserved

404Gmostly conserved

413Tmostly conserved

419Amostly conserved

431Avariable

434Tmostly conserved

440Tmostly conserved

446Gmostly conserved

452Tmostly conserved

461Gvariable

464Gmostly conserved

468Tvariable

470Gvariable

473Tvariable

476Gvariable

497Amostly conserved

498Cvariable

503Tvariable

506Avariable

ACTCTGGAAGTTTAATTGGGGATGATCAGATTTATAATGTGATTGTAACGGCGCATGCTTTTGTGATAATTTTTTTTATGGTTATGCCTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.0%

Haplotypes8

BINs3

Most divergent pair12.0%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Appalachioria eutypasame genus4.5%Appalachioria falciferasame genus4.9%Rudiloria trimaculatasame family8.6%Deltotaria brimleiisame family8.6%Sigmoria latiorsame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor3

Museum / vouchered23

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 18

18 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blacksburg, US	23

1 institutions · 23 of 23 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Appalachioria separanda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 10.2–11.7

Seasonal swing summer↔winter21.9 °C

Max temp (day)15.5 °C 15.3–16.9

Min temp (night)6.10 °C 5.70–7.00

Precipitation90.9 mm/mo 86.7–102

Air humidity59.1 % 58.6–59.7

Moisture balance2.20 mm/mo -4.00–10.4

Vapour deficit595 Pa 550–629

Wind speed3.10 m/s 2.50–4.00

Cloud cover42.7 % 42.4–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)