Aphelinus asychis

Walker, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Aphelinidae/Aphelinus

At a glance

Occurrence records126

Data sources7

Biological traits0

DNA specimens107

eDNA detections58

Sources7 archives

Databases and archives Aphelinus asychis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics107 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF126 records

Environmental DNA2 datasets · 10 countries58 detections

DNA & barcodingBOLD107 specimens

01Narrative

Aphelinus asychis is a parasitoid wasp native to Eurasia that was introduced to North America to control the Russian wheat aphid. Recent work shows that the species as currently described does not form a monophyletic group and its taxonomy and phylogenetic relationship should be re-examined.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding107 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphelinus asychis has left across the world's sequence archives.

At a glance

DNA specimens107

BINs5

Marker genes3

eDNA detections58

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus92 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

21Tmostly conserved

27Gmostly conserved

33Amostly conserved

58Amostly conserved

66Tmostly conserved

72Gvariable

81Tmostly conserved

84Amostly conserved

87Tmostly conserved

132Tmostly conserved

189Amostly conserved

213Gmostly conserved

219Tmostly conserved

220Cmostly conserved

222Avariable

234Tvariable

270Tmostly conserved

282Gmostly conserved

297Tvariable

309Avariable

312Amostly conserved

315Avariable

330Gvariable

363Tmostly conserved

372Cvariable

459Tmostly conserved

465Amostly conserved

504Gmostly conserved

531Avariable

558Tmostly conserved

561Tvariable

564Tvariable

567Tmostly conserved

573Avariable

609Tmostly conserved

612Avariable

618Tvariable

621Amostly conserved

624Tmostly conserved

627Cvariable

630Tmostly conserved

ATTTTATATTTTATTTTTGGTATATGGGCAGGAATTTTAGGATTATCAATAAGAATAATTATTCGTTTAGAGTTAGGAAATCCAGGTTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes17

BINs5

Most divergent pair5.4%

N.AmericaEuropeOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphelinus abdominalissame genus7.1%Aphelinus gossypiisame genus8.5%Aphelinus humilissame genus8.9%Aphelinus paramalisame genus9.0%Sympiesis acallesame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type126 records

Wild obs. + sensor7

Museum / vouchered119

Origin

Introduced2

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 1≤1 km 2≤10 km 1>10 km 3

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 4≤1 km 3≤10 km 4

11 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	52
Agricultural Research Council-Plant Protection Research Institutelocation not on record	20
University of Central Floridalocation not on record	10
NHMOlocation not on record	3
MWLRlocation not on record	2
New Zealand Arthropod Collectionlocation not on record	2
Eszterhazy Karoly University of Applied Scienceslocation not on record	2
Barcelona, ES	1
Helsinki, FI	1
South Kensington, GB	1

10 institutions · 94 of 119 vouchered records shown · 24 without an institution code

09Environmental DNA58 detections

Where the DNA of Aphelinus asychis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys2

Countries10

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map10 countries0

4. Native GrasslandCorn14. Artificial - Terrestrial | 14.5 Urban Ar…5. Wetlands (inland)1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 11.3–21.3

Seasonal swing summer↔winter18.9 °C

Max temp (day)20.3 °C 15.5–27.3

Min temp (night)12.9 °C 7.10–15.9

Precipitation105 mm/mo 39.5–151

Air humidity60.6 % 54.1–64.7

Moisture balance-2.80 mm/mo -85.4–32.0

Vapour deficit746 Pa 529–1,154

Wind speed2.80 m/s 1.70–4.20

Cloud cover38.5 % 30.8–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 54 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)