Aphelinus humilis

Mercet, 1927 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Aphelinidae/Aphelinus

At a glance

Occurrence records4

Data sources6

Biological traits0

DNA specimens7

eDNA detections1

Sources6 archives

Databases and archives Aphelinus humilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

Aphelinus humilis is een vliesvleugelig insect uit de familie Aphelinidae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1927 door Mercet.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphelinus humilis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P680 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 130 variable positions, in barcode order

1Tmostly conserved

7Gmostly conserved

8Tmostly conserved

22Amostly conserved

23Tmostly conserved

24Amostly conserved

25Tmostly conserved

40Gmostly conserved

46Tmostly conserved

49Gmostly conserved

50Gmostly conserved

64Amostly conserved

94Tmostly conserved

115Amostly conserved

148Gmostly conserved

190Gmostly conserved

235Amostly conserved

238Amostly conserved

256Amostly conserved

271Gmostly conserved

278Tmostly conserved

280Amostly conserved

289Tmostly conserved

307Gmostly conserved

310Amostly conserved

313Gmostly conserved

316Gmostly conserved

325Amostly conserved

331Tmostly conserved

337Cmostly conserved

340Tmostly conserved

349Amostly conserved

367Amostly conserved

385Tmostly conserved

388Cmostly conserved

391Tmostly conserved

397Tmostly conserved

406Amostly conserved

416Cvariable

418Amostly conserved

427Tmostly conserved

465Gmostly conserved

475Amostly conserved

495Tmostly conserved

497Gmostly conserved

498Amostly conserved

502Tmostly conserved

503Amostly conserved

504Tmostly conserved

507Cmostly conserved

508Tmostly conserved

511Amostly conserved

512Tmostly conserved

516Cmostly conserved

517Tmostly conserved

519Gmostly conserved

532Gmostly conserved

565Gvariable

566Tmostly conserved

567Tmostly conserved

568Amostly conserved

569Gmostly conserved

570Cmostly conserved

571Tvariable

572Gmostly conserved

574Tmostly conserved

575Gmostly conserved

576Cmostly conserved

577Amostly conserved

578Amostly conserved

579Tmostly conserved

580Tmostly conserved

581Amostly conserved

582Cmostly conserved

586Amostly conserved

587Tvariable

589Amostly conserved

590Tmostly conserved

592Avariable

594Tmostly conserved

595Tmostly conserved

596Gmostly conserved

597Amostly conserved

598Tmostly conserved

599Cmostly conserved

600Gmostly conserved

601Tvariable

602Amostly conserved

603Amostly conserved

605Tmostly conserved

606Tmostly conserved

608Amostly conserved

610Tmostly conserved

611Amostly conserved

612Cmostly conserved

613Tmostly conserved

615Cmostly conserved

621Tmostly conserved

622Tmostly conserved

623Gmostly conserved

624Amostly conserved

625Tmostly conserved

626Cmostly conserved

627Cmostly conserved

628Tmostly conserved

629Gmostly conserved

630Cmostly conserved

631Tvariable

632Gmostly conserved

634Amostly conserved

637Gmostly conserved

638Gmostly conserved

640Tvariable

641Gmostly conserved

642Amostly conserved

643Tvariable

644Cmostly conserved

645Cmostly conserved

646Avariable

647Amostly conserved

+10 more variable positions not shown

TCATAAGTATATTGGAATTTTATATTTTATTTTTGGTATGTGAGCTGGGGTTTTAGGTTTATCAATAAGTTTAATTATTCGTTTAGAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.9%

Haplotypes4

BINs2

Most divergent pair7.5%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphelinus gossypiisame genus5.3%Aphelinus paramalisame genus5.4%Aphelinus perpallidussame genus6.1%Aphelinus abdominalissame genus7.4%Trichogramma galloisame order9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Wild obs. + sensor2

Museum / vouchered2

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Wellcome Sanger Institutelocation not on record	1
Agricultural Research Council-Plant Protection Research Institutelocation not on record	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aphelinus humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.90 °C 7.90–7.90

Seasonal swing summer↔winter11.3 °C

Max temp (day)10.3 °C

Min temp (night)4.50 °C

Precipitation120 mm/mo

Air humidity67.5 %

Moisture balance50.1 mm/mo

Vapour deficit364 Pa

Wind speed6.10 m/s

Cloud cover50.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)