Aphelia alleniana

(Fernald, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Aphelia

At a glance

Occurrence records259

Data sources8

Biological traits0

DNA specimens119

eDNA detections5

Sources8 archives

Databases and archives Aphelia alleniana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility259 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics119 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF259 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD119 specimens

01Narrative

Aphelia alleniana, the wide-striped leafroller, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded throughout Canada, as far north as Alaska. In the United States, it has been recorded from Colorado, Maine and Montana. The wingspan is 21–27 mm.mothphotographersgroup The forewings are light brown with fine darker brown reticulations. The hindwings are dull greyish brown. Adults are on wing from late June to mid-July. The larvae mostly feed on herbaceous plants, but may also feed on deciduous and coniferous woody plants. The larvae are light green with a dark green dorsal stripe and a yellow head. The species overwinters as a third instar larva in a folded leaf.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding119 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphelia alleniana has left across the world's sequence archives.

At a glance

DNA specimens119

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus114 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

250Tmostly conserved

542Cvariable

547Cvariable

TACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTAATAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes12

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphelia viburnianasame genus1.7%Aphelia peramplanasame genus5.8%Aphelia albocilianasame genus6.1%Archips dissitanasame family6.5%Argyrotaenia lautanasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type259 records

Wild obs. + sensor62

Museum / vouchered197

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 46≤1 km 4>10 km 1

51 georeferenced · 11 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 9≤1 km 1≤10 km 13

23 georeferenced · 174 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	55
University of Guelph, Centre for Biodiversity Genomicslocation not on record	33
Royal Saskatchewan Museumlocation not on record	14
East Lansing, US	12
Colorado State Universitylocation not on record	9
St. Paul, US	8
Mississippi State, US	4
Research Collection of Daniel Handfieldlocation not on record	4
Cornell University Insect Collectionlocation not on record	2
New Haven, US	1
Vernal, US	1
San Francisco, US	1
Edmonton, CA	1
Centre for Biodiversity Genomicslocation not on record	1
Essig Museum of Entomologylocation not on record	1

15 institutions · 147 of 197 vouchered records shown · 50 without an institution code

09Environmental DNA5 detections

Where the DNA of Aphelia alleniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 12.4–16.7

Seasonal swing summer↔winter28.8 °C

Max temp (day)21.4 °C 16.8–21.4

Min temp (night)10.4 °C 8.20–12.1

Precipitation90.7 mm/mo 61.7–140

Air humidity59.5 % 57.8–60.5

Moisture balance-3.50 mm/mo -44.2–12.2

Vapour deficit767 Pa 568–782

Wind speed2.80 m/s 2.00–2.90

Cloud cover46.8 % 43.3–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)