Aphanius fasciatus

(Valenciennes, 1821) · species

image placeholder — illustration coming later

Animalia/Chordata/Cyprinodontiformes/Cyprinodontidae/Aphanius

At a glance

Occurrence records951

Data sources10

Biological traits0

DNA specimens52

eDNA detections110

Sources10 archives

Databases and archives Aphanius fasciatus's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility873 records↗

OBISOcean Biodiversity Information System78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS951 records

Environmental DNA1 datasets · 4 countries110 detections

DNA & barcodingBOLD52 specimens

01Narrative

The Mediterranean killifish, Mediterranean banded killifish or South European toothcarp (Aphanius fasciatus) is a species of fish in the family Cyprinodontidae. It is found in Albania, Algeria, Bosnia and Herzegovina, Croatia, Cyprus, Egypt, France, Greece, Israel, Italy, Lebanon, Libya, Malta, Morocco, Montenegro, Slovenia, Syria, Tunisia, and Turkey. Its natural habitats are saline lakes, saline marshes, and coastal saline lagoons.Kottelat, M. and J. Freyhof, 2007. Handbook of European freshwater fishes. Publications Kottelat, Cornol and Freyhof, Berlin. 646 pp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphanius fasciatus has left across the world's sequence archives.

At a glance

DNA specimens52

BINs1

Marker genes1

eDNA detections110

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P611 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

40Cvariable

61Gmostly conserved

85Gmostly conserved

157Avariable

160Avariable

193Amostly conserved

196Gmostly conserved

274Cmostly conserved

304Avariable

436Tvariable

511Avariable

514Gmostly conserved

589Tmostly conserved

CTGAGCGGGAATGGTAGGCACAGCCTTAAGCCTTTTAATCCGAGCTGAACTTAGTCAACCGGGCTCTCTCTTGGGAGACGACCAGATCTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes9

BIN1

Most divergent pair1.8%

EuropeAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphanius almiriensissame genus3.9%Aphanius transgredienssame genus13.0%Aphanius anatoliaesame genus13.1%Aphanius vladykovisame genus14.3%Aphanius darabensissame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type951 records

Wild obs. + sensor231

Museum / vouchered584

Other136

Origin

Introduced1

Range

Area of Occupancy AOO1 132 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.4 m · max 0.5 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 77≤1 km 18≤10 km 70>10 km 17

182 georeferenced · 49 without coordinates

Open the mapobservation + sensor231

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 12≤1 km 18≤10 km 4>10 km 15

49 georeferenced · 535 without coordinates

Open the institutions mapphysical evidence584

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	391
FishBaselocation not on record	20
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	16
South Kensington, GB	14
SNSB-Zoologische Staatssammlung Münchenlocation not on record	12
Royal Museum for Central Africalocation not on record	9
Paris, FR	8
	8
Stockholm, SE	7
Cantablocation not on record	5
Brussels, BE	5
Cambridge, US	4
RBINS-Scientific Heritagelocation not on record	4
Helsinki, FI	3
National Natural History Collectionslocation not on record	3
Chicago, US	3
Geneva, CH	2
South African Institute for Aquatic Biodiversitylocation not on record	2
HUJIlocation not on record	1
CASlocation not on record	1
Berkeley, US	1
Ann Arbor, US	1
University of California San Diegolocation not on record	1

23 institutions · 521 of 584 vouchered records shown · 16 without an institution code

09Environmental DNA110 detections

Where the DNA of Aphanius fasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 14.5–19.7

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 18.0–25.4

Min temp (night)10.1 °C 9.30–13.3

Precipitation72.2 mm/mo 29.2–114

Air humidity58.3 % 54.4–60.4

Moisture balance-20.6 mm/mo -86.7–8.80

Vapour deficit782 Pa 777–1,137

Wind speed2.80 m/s 2.60–3.70

Cloud cover40.9 % 23.1–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)