Aphanius almiriensis

Kottelat, Barbieri & Stoumboudi, 2007 · species

image placeholder — illustration coming later

Animalia/Chordata/Cyprinodontiformes/Cyprinodontidae/Aphanius

At a glance

Occurrence records33

Data sources7

Biological traits5

DNA specimens17

eDNA detections0

Sources7 archives

Databases and archives Aphanius almiriensis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF33 records

DNA & barcodingBOLD17 specimens

01Narrative

The Almiri toothcarp or Almiri killifish (Aphanius almiriensis) is a species of pupfish belonging to the family Cyprinodontidae. It can be found in a handful of brackish springs and marshes in the Peloponnese, Greece. Due to one of the springs being dammed up with rocks in the late 1990s to early 2000s, the IUCN considers the fish to be critically endangered on criteria B1ab(i,ii,iii,iv.v) and B2ab(i,ii,iii,iv,v); it is possibly extinct at its type locality.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length2.85 cm

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphanius almiriensis has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P461 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.39%

Haplotypes2

BIN1

Most divergent pair0.22%

Where individuals differ — all 6 variable positions, in barcode order

69Gvariable

387Tmostly conserved

414Cvariable

456Cvariable

458Cmostly conserved

460Gmostly conserved

GTAATACCCATTATAATTGGAGGATTTGGAAACTGATTAATCCCCTTAATGATTGGAGCACCTGATATGGCCTTCCCACGAATAAATAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphanius fasciatussame genus3.9%Aphanius transgredienssame genus13.7%Aphanius anatoliaesame genus14.3%Aphanius darabensissame genus14.3%Aphanius vladykovisame genus14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor11

Museum / vouchered9

Other13

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 2≤1 km 5≤10 km 1>10 km 3

11 georeferenced

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	4
Geneva, CH	1

2 institutions · 5 of 9 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)