Aphalara polygoni

Foerster, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphalaridae/Aphalara

At a glance

Occurrence records172

Data sources3

Biological traits0

DNA specimens4

eDNA detections0

Sources3 archives

Databases and archives Aphalara polygoni's data was compiled from.

GBIFGlobal Biodiversity Information Facility172 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF172 records

DNA & barcodingBOLD4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphalara polygoni has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P453 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.6%

Haplotypes2

BINs2

Most divergent pair3.8%

Where individuals differ — all 17 variable positions, in barcode order

12Avariable

24Avariable

30Cvariable

36Cvariable

46Tvariable

54Cvariable

79Tvariable

144Tvariable

264Gvariable

294Cvariable

297Tvariable

384Tvariable

411Cvariable

414Avariable

436Cvariable

447Tvariable

448Cvariable

TTAATAATTGGAGCTCCAGATATAGCTTTCCCCCGCCTAAATAATTTAAGATTCTGACTTTTATTACCATCAATATATTTATTAATTTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphalara affinissame genus7.5%Craspedolepta schwarzisame family13.0%Craspedolepta subpunctatasame family14.8%Aphalara itadorisame genus15.2%Pariaconus pelesame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type172 records

Wild obs. + sensor31

Museum / vouchered138

Fossil3

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 13≤1 km 9≤10 km 8>10 km 1

31 georeferenced

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 45≤1 km 58≤10 km 1

104 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	51
Stockholm, SE	23
Moravské zemské muzeum [Moravian Museum]location not on record	16
Metsähallituslocation not on record	9
Sofia University "St. Kliment Ohridski"location not on record	7
MnhnLlocation not on record	5
SLU Artdatabankenlocation not on record	5
MZLUlocation not on record	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1

9 institutions · 121 of 138 vouchered records shown · 17 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)