Aphalara itadori

(Shinji, 1938) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphalaridae/Aphalara

At a glance

Occurrence records2

Data sources8

Biological traits0

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Aphalara itadori's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Aphalara itadori, the Japanese knotweed psyllid, is a species of psyllid from Japan which feeds on Japanese knotweed (Reynoutria japonica). It has been licensed by the UK Government for the biological control of Japanese knotweed in England; this was the first time that biological control of a weed was sanctioned in the European Union. The specific name comes from , the Japanese name for Japanese knotweed.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphalara itadori has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P675 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.39%

Haplotypes2

BIN1

Most divergent pair0.59%

Where individuals differ — all 6 variable positions, in barcode order

246Tvariable

249Tvariable

364Amostly conserved

492Cvariable

537Tmostly conserved

624Tvariable

AAAGATATTGGAACTCTTTATTTCATTATAGGAATTTGATCAGGATTAATTGGCTTATCTTTAAGAATTATCATTCGTATAGAATTAAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphalara affinissame genus14.1%Craspedolepta innoxiasame family15.8%Craspedolepta schwarzisame family16.7%Trioza erytreaesame order17.0%Trioza rhamnisame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 records

Wild obs. + sensor2

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA8 detections

Where the DNA of Aphalara itadori was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)