Aphaenogaster treatae

Forel, 1886 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Aphaenogaster

At a glance

Occurrence records1 210

Data sources7

Biological traits0

DNA specimens7

eDNA detections0

Sources7 archives

Databases and archives Aphaenogaster treatae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 210 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 210 records

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · TreeOfSex489 Mbp

01Narrative

Aphaenogaster treatae is een mierensoort uit de onderfamilie van de Myrmicinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1886 door Forel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaenogaster treatae has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.96%

Haplotypes1

BIN1

Where individuals differ — all 15 variable positions, in barcode order

46Tmostly conserved

52Amostly conserved

59Amostly conserved

97Cmostly conserved

319Amostly conserved

361Amostly conserved

368Tmostly conserved

412Amostly conserved

415Amostly conserved

474Cmostly conserved

485Amostly conserved

589Cmostly conserved

607Cmostly conserved

616Cmostly conserved

640Cmostly conserved

AATTCTATATTTTATTCTTGCTATTTGATCAGGAATAATTGGATCTTCCATAAGAATAATTATTCGACTAGAACTAGGATCCTGTAACTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaenogaster rudissame genus4.2%Aphaenogaster lamellidenssame genus5.3%Aphaenogaster carolinensissame genus5.4%Aphaenogaster texanasame genus5.5%Aphaenogaster miamianasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aphaenogaster treatae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size489 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphaenogaster treatae0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Chromosome records42–422n range42median42mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 423×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera: Formicidae), with a review of the known ant chromosome numbers. Myrmecological News 13: 89-102. ↗

2n 211×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type1 210 records

Wild obs. + sensor150

Museum / vouchered1 060

Range

Area of Occupancy AOO1 240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 70≤1 km 15≤10 km 6>10 km 21

112 georeferenced · 38 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 40≤1 km 94≤10 km 83>10 km 48

265 georeferenced · 795 without coordinates

Open the institutions mapphysical evidence1 060

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	340
CASlocation not on record	317
Cambridge, US	216
College Station, US	37
Chicago, US	31
Lake Placid, US	30
Cornell University Insect Collectionlocation not on record	24
OSUClocation not on record	15
Washington, US	15
EL PASO, US	8
US	8
University of Nebraska State Museumlocation not on record	6
Universidad Católica de Manizaleslocation not on record	3
Champaign, US	3
Lubbock, US	2
CUlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
University of Central Floridalocation not on record	1

18 institutions · 1 058 of 1 060 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphaenogaster treatae

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 210 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 18 geolocated

Record type1 210 records