Aphaenogaster rudis

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Aphaenogaster

At a glance

Occurrence records3 297

Data sources8

Biological traits0

DNA specimens62

eDNA detections0

Sources8 archives

Databases and archives Aphaenogaster rudis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 297 records↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 297 records

DNA & barcodingBOLD62 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈430 Mbp

01Narrative

Aphaenogaster rudis is een mierensoort uit de onderfamilie van de Myrmicinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1947 door Enzmann, J..

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaenogaster rudis has left across the world's sequence archives.

At a glance

DNA specimens62

BINs7

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

5Cmostly conserved

46Tvariable

115Tmostly conserved

118Cmostly conserved

136Cvariable

151Cmostly conserved

163Amostly conserved

166Amostly conserved

172Cmostly conserved

175Amostly conserved

184Amostly conserved

190Cmostly conserved

202Tmostly conserved

212Cmostly conserved

217Tvariable

220Amostly conserved

229Amostly conserved

232Amostly conserved

235Tvariable

250Tvariable

256Amostly conserved

271Cmostly conserved

278Cmostly conserved

280Tvariable

293Amostly conserved

304Tvariable

310Tvariable

316Amostly conserved

331Avariable

337Cvariable

340Cmostly conserved

343Tmostly conserved

346Tvariable

349Avariable

358Tvariable

364Tmostly conserved

373Avariable

394Tvariable

400Tmostly conserved

424Amostly conserved

427Tvariable

430Amostly conserved

433Amostly conserved

436Tvariable

445Tmostly conserved

454Cmostly conserved

469Cmostly conserved

474Tmostly conserved

478Tmostly conserved

496Tvariable

508Avariable

529Cvariable

539Tmostly conserved

547Cvariable

548Cmostly conserved

553Tmostly conserved

559Cvariable

562Avariable

581Tmostly conserved

595Cmostly conserved

616Cmostly conserved

619Cvariable

622Amostly conserved

625Tvariable

628Amostly conserved

631Cmostly conserved

640Tvariable

646Tvariable

649Amostly conserved

AATTCTATATTTTATTCTTGCTATTTGATCAGGAATAATTGGATCTTCTATAAGAATGATTATTCGATTAGAACTAGGATCATGTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes12

BINs6

Most divergent pair7.1%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaenogaster carolinensissame genus2.5%Aphaenogaster texanasame genus2.6%Aphaenogaster miamianasame genus2.6%Aphaenogaster lamellidenssame genus2.8%Aphaenogaster treataesame genus4.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Aphaenogaster rudis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈429 703 865 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphaenogaster rudis0.43 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Chromosome records20–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera: Formicidae), with a review of the known ant chromosome numbers. Myrmecological News 13: 89-102. ↗

2n 201×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.8% BUSCO

08Occurrence & distribution

Record type3 297 records

Wild obs. + sensor1 071

Museum / vouchered2 226

Range

Area of Occupancy AOO4 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 597≤1 km 127≤10 km 28>10 km 83

835 georeferenced · 236 without coordinates

Open the mapobservation + sensor1 071

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 129≤1 km 229≤10 km 534>10 km 85

977 georeferenced · 1 249 without coordinates

Open the institutions mapphysical evidence2 226

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	1 243
CASlocation not on record	351
EL PASO, US	146
UDlocation not on record	138
Cornell University Insect Collectionlocation not on record	118
Chicago, US	111
Mississippi State, US	27
OSUClocation not on record	17
University of Alabamalocation not on record	8
University of Nebraska State Museumlocation not on record	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Lubbock, US	4
US	4
CUlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
McGill University, Lyman Entomological Museumlocation not on record	2
Wuzhou, CN	2
New Haven, US	1
WIlocation not on record	1

19 institutions · 2 188 of 2 226 vouchered records shown · 38 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphaenogaster rudis

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 297 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Record type3 297 records