Aphaenogaster tennesseensis

(Mayr, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Aphaenogaster

At a glance

Occurrence records2 556

Data sources7

Biological traits0

DNA specimens21

eDNA detections25

Sources7 archives

Databases and archives Aphaenogaster tennesseensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 556 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 556 records

Environmental DNA1 datasets · 2 countries25 detections

DNA & barcodingBOLD21 specimens

01Narrative

Aphaenogaster tennesseensis is a species of ant in the family Formicidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaenogaster tennesseensis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections25

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 91 variable positions, in barcode order

2Avariable

19Amostly conserved

26Tmostly conserved

46Amostly conserved

58Amostly conserved

67Cmostly conserved

68Cmostly conserved

74Tmostly conserved

85Cmostly conserved

88Cmostly conserved

92Tmostly conserved

94Amostly conserved

97Tvariable

112Cmostly conserved

118Tmostly conserved

121Cmostly conserved

136Cmostly conserved

145Cmostly conserved

151Tmostly conserved

154Cmostly conserved

157Cmostly conserved

160Gvariable

181Tmostly conserved

184Amostly conserved

190Tmostly conserved

196Tmostly conserved

197Cmostly conserved

206Cmostly conserved

212Tmostly conserved

217Cmostly conserved

232Cmostly conserved

238Amostly conserved

241Amostly conserved

271Gmostly conserved

274Cmostly conserved

280Amostly conserved

286Amostly conserved

292Tmostly conserved

307Tmostly conserved

309Gmostly conserved

310Amostly conserved

311Tmostly conserved

312Cmostly conserved

334Cmostly conserved

340Cmostly conserved

343Amostly conserved

347Cmostly conserved

359Amostly conserved

367Cvariable

373Amostly conserved

385Tmostly conserved

412Cmostly conserved

433Cvariable

436Cmostly conserved

439Cmostly conserved

448Cmostly conserved

454Tmostly conserved

469Tmostly conserved

478Tmostly conserved

479Tmostly conserved

484Tmostly conserved

496Tmostly conserved

514Cmostly conserved

518Amostly conserved

523Cmostly conserved

526Amostly conserved

529Cmostly conserved

532Tmostly conserved

533Cmostly conserved

538Cmostly conserved

539Cmostly conserved

541Tmostly conserved

542Cmostly conserved

547Amostly conserved

548Tmostly conserved

553Amostly conserved

559Amostly conserved

562Tmostly conserved

565Tmostly conserved

571Cmostly conserved

589Tmostly conserved

596Tmostly conserved

604Tmostly conserved

607Tmostly conserved

616Tmostly conserved

619Tmostly conserved

622Cmostly conserved

625Avariable

631Tmostly conserved

637Cmostly conserved

646Tmostly conserved

AATCCTCTATTTTATTCTAGCTATTTGATCAGGAATAATTGGATCATCTATAAGAATAATTATTCGCCTAGAATTAGGATCATGCAACTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes3

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaenogaster epirotessame genus12.2%Aphaenogaster smythiesiisame genus12.5%Aphaenogaster illyricasame genus12.6%Aphaenogaster caeciliaesame genus12.9%Aphaenogaster rudissame genus13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 556 records

Wild obs. + sensor1 724

Museum / vouchered832

Range

Area of Occupancy AOO5 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 865≤1 km 270≤10 km 91>10 km 141

1 367 georeferenced · 357 without coordinates

Open the mapobservation + sensor1 724

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 16≤1 km 71≤10 km 93>10 km 7

187 georeferenced · 645 without coordinates

Open the institutions mapphysical evidence832

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	247
Mississippi State, US	162
OSUClocation not on record	84
Champaign, US	80
Cambridge, US	55
UDlocation not on record	53
Chicago, US	52
Cornell University Insect Collectionlocation not on record	28
EL PASO, US	26
Cleveland Museum of Natural History, OH (CLEV)location not on record	16
Universidad Católica de Manizaleslocation not on record	4
University of Guelphlocation not on record	3
Lubbock, US	3
Decorah, US	3
California Academy of Scienceslocation not on record	2
Montgomery, US	2
Lake Placid, US	2
Wuzhou, CN	1
WIlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

20 institutions · 825 of 832 vouchered records shown · 7 without an institution code

09Environmental DNA25 detections

Where the DNA of Aphaenogaster tennesseensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map2 countries0

Moist hardwood forestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.3 °C 12.4–24.0

Seasonal swing summer↔winter27.2 °C

Max temp (day)22.2 °C 15.8–29.2

Min temp (night)12.9 °C 10.2–19.2

Precipitation96.2 mm/mo 83.7–108

Air humidity58.8 % 57.0–59.5

Moisture balance-41.8 mm/mo -81.8–-9.30

Vapour deficit836 Pa 592–1,243

Wind speed5.60 m/s 2.60–6.40

Cloud cover41.2 % 33.2–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphaenogaster tennesseensis

At a glance

Sources7 archives

At a glance

Record type2 556 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 556 records