Aphaenogaster subterranea

(Latreille, 1798) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Aphaenogaster

At a glance

Occurrence records4 178

Data sources9

Biological traits0

DNA specimens148

eDNA detections109

Sources9 archives

Databases and archives Aphaenogaster subterranea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 178 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI109 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics148 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 178 records

Environmental DNA1 datasets · 5 countries109 detections

DNA & barcodingBOLD148 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈415 Mbp

01Narrative

Aphaenogaster subterranea is een mierensoort uit de onderfamilie van de Myrmicinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1798 door Latreille.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding148 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaenogaster subterranea has left across the world's sequence archives.

At a glance

DNA specimens148

BINs11

Marker genes1

eDNA detections109

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus145 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 78 variable positions, in barcode order

4Tmostly conserved

13Cmostly conserved

16Tmostly conserved

19Tmostly conserved

31Gmostly conserved

40Cmostly conserved

43Amostly conserved

49Cmostly conserved

55Amostly conserved

64Tmostly conserved

82Cmostly conserved

88Cmostly conserved

92Tmostly conserved

103Tvariable

106Tmostly conserved

118Cvariable

121Cmostly conserved

124Amostly conserved

136Tvariable

154Tmostly conserved

181Amostly conserved

205Tmostly conserved

212Cmostly conserved

214Amostly conserved

232Cmostly conserved

235Tmostly conserved

262Gvariable

271Cvariable

274Amostly conserved

283Cmostly conserved

292Cmostly conserved

298Amostly conserved

301Gvariable

310Gvariable

312Amostly conserved

313Tmostly conserved

316Amostly conserved

319Cmostly conserved

322Tmostly conserved

328Amostly conserved

337Tvariable

349Avariable

352Tmostly conserved

367Tmostly conserved

370Amostly conserved

373Amostly conserved

376Cmostly conserved

394Tmostly conserved

412Amostly conserved

421Cmostly conserved

424Avariable

428Cmostly conserved

430Amostly conserved

433Tmostly conserved

442Tmostly conserved

469Cmostly conserved

474Tmostly conserved

478Cmostly conserved

518Tmostly conserved

538Cvariable

542Cmostly conserved

547Cmostly conserved

548Cmostly conserved

550Gvariable

559Tmostly conserved

574Tmostly conserved

589Cmostly conserved

596Cmostly conserved

598Avariable

604Amostly conserved

607Cmostly conserved

610Cmostly conserved

616Cvariable

625Gvariable

631Amostly conserved

634Tmostly conserved

637Cmostly conserved

646Tmostly conserved

TATTCTTTATTTCATTCTTGCTATTTGATCGGGAATAATCGGATCTTCCATAAGAATAATTATTCGATTAGAATTAGGATCCTGTAACTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes26

BINs11

Most divergent pair10.2%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaenogaster ichnusasame genus9.0%Aphaenogaster illyricasame genus9.6%Aphaenogaster rudissame genus9.8%Aphaenogaster epirotessame genus9.9%Messor atanassoviisame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Aphaenogaster subterranea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈415 391 653 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphaenogaster subterranea0.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera: Formicidae), with a review of the known ant chromosome numbers. Myrmecological News 13: 89-102. ↗

2n 111×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type4 178 records

Wild obs. + sensor2 889

Museum / vouchered1 289

Origin

Native779

Range

Area of Occupancy AOO5 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 222≤1 km 193≤10 km 1 573>10 km 30

2 018 georeferenced · 871 without coordinates

Open the mapobservation + sensor2 889

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 12≤1 km 38≤10 km 792

842 georeferenced · 447 without coordinates

Open the institutions mapphysical evidence1 289

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	363
CASlocation not on record	214
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	194
Brussels, BE	70
NMOKlocation not on record	60
Cornell University Insect Collectionlocation not on record	46
Zürich, CH	43
CEFElocation not on record	27
Muzeum Górnośląskie w Bytomiulocation not on record	18
Natural History Museum of Utahlocation not on record	7
ZSMlocation not on record	4
Barcelona, ES	4
Universite Montpellier, CEFE Lablocation not on record	2
Cambridge, US	2
EL PASO, US	2
Washington, US	2
Paris, FR	1
Lubbock, US	1
RBINS-Scientific Heritagelocation not on record	1

19 institutions · 1 061 of 1 289 vouchered records shown · 228 without an institution code

09Environmental DNA109 detections

Where the DNA of Aphaenogaster subterranea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found109

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 109 detections have coordinates

Open the map5 countries0

oaks in openRiparian forestChenaieUrban pine forestUrban areaEcoulement temporaire flanc vallee et maquis

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 12.7–21.1

Seasonal swing summer↔winter15.8 °C

Max temp (day)19.1 °C 16.2–25.8

Min temp (night)13.2 °C 7.70–17.5

Precipitation58.2 mm/mo 32.7–90.3

Air humidity59.4 % 54.8–61.7

Moisture balance-51.2 mm/mo -114–48.9

Vapour deficit781 Pa 624–1,127

Wind speed2.90 m/s 2.00–4.90

Cloud cover39.8 % 28.7–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 105 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphaenogaster subterranea

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type4 178 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 178 records