Aphaenogaster picea

(Wheeler, 1908) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Aphaenogaster

At a glance

Occurrence records1 606

Data sources9

Biological traits0

DNA specimens32

eDNA detections11

Sources9 archives

Databases and archives Aphaenogaster picea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 606 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 606 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD32 specimens

Genome at a glanceGoaT · NCBI≈386 Mbp

01Narrative

Aphaenogaster picea is a species of ant in the family Formicidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaenogaster picea has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

112Tmostly conserved

115Cmostly conserved

118Tmostly conserved

151Tmostly conserved

163Tmostly conserved

166Gmostly conserved

175Gmostly conserved

196Cmostly conserved

202Cmostly conserved

217Gmostly conserved

220Tmostly conserved

235Cmostly conserved

238Cmostly conserved

241Tmostly conserved

256Gvariable

280Tmostly conserved

304Tmostly conserved

316Tmostly conserved

331Amostly conserved

340Cvariable

343Cmostly conserved

397Tmostly conserved

400Cmostly conserved

424Cmostly conserved

430Gmostly conserved

433Cvariable

469Cmostly conserved

474Cmostly conserved

496Tmostly conserved

499Tmostly conserved

508Amostly conserved

532Cmostly conserved

539Cmostly conserved

548Tmostly conserved

553Cmostly conserved

559Cmostly conserved

578Tmostly conserved

581Cmostly conserved

625Tmostly conserved

628Gmostly conserved

649Gvariable

AATTCTATATTTTATTCTTGCTATTTGATCAGGAATAATTGGATCTTCTATAAGAATGATTATTCGATTAGAACTAGGATCATGTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes8

BINs2

Most divergent pair6.5%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaenogaster rudissame genus4.9%Aphaenogaster texanasame genus6.8%Aphaenogaster miamianasame genus6.8%Aphaenogaster carolinensissame genus6.8%Aphaenogaster lamellidenssame genus6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphaenogaster picea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈386 044 929 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphaenogaster picea0.39 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.7% BUSCO

08Occurrence & distribution

Record type1 606 records

Wild obs. + sensor549

Museum / vouchered1 057

Range

Area of Occupancy AOO2 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 278≤1 km 96≤10 km 14>10 km 52

440 georeferenced · 109 without coordinates

Open the mapobservation + sensor549

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 176≤1 km 17≤10 km 128>10 km 2

323 georeferenced · 734 without coordinates

Open the institutions mapphysical evidence1 057

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	298
Cambridge, US	254
OSUClocation not on record	163
EL PASO, US	128
Champaign, US	64
Mississippi State, US	60
Chicago, US	36
Cleveland Museum of Natural History, OH (CLEV)location not on record	35
CUlocation not on record	7
Decorah, US	2
Toronto, CA	2
Cornell University Insect Collectionlocation not on record	2
Royal Ontario Museumlocation not on record	2
WIlocation not on record	1
Lake Placid, US	1

15 institutions · 1 055 of 1 057 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Aphaenogaster picea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 4.40–19.3

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.9 °C 8.10–23.4

Min temp (night)14.2 °C 1.80–16.2

Precipitation84.7 mm/mo 65.4–84.7

Air humidity57.7 % 57.7–63.6

Moisture balance-57.7 mm/mo -57.7–-17.4

Vapour deficit855 Pa 504–898

Wind speed2.90 m/s 2.60–4.50

Cloud cover41.1 % 41.1–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphaenogaster picea

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 606 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 606 records