Apethymus apicalis

(Klug, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Apethymus

At a glance

Occurrence records119

Data sources6

Biological traits0

DNA specimens10

eDNA detections8

Sources6 archives

Databases and archives Apethymus apicalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF119 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD10 specimens

01Narrative

Apethymus apicalis is een vliesvleugelig insect uit de familie van de bladwespen (Tenthredinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1818 door Klug.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apethymus apicalis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.73%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 16 variable positions, in barcode order

33Amostly conserved

66Tmostly conserved

84Cmostly conserved

87Cmostly conserved

180Gmostly conserved

183Gmostly conserved

204Tmostly conserved

216Amostly conserved

219Tmostly conserved

282Tvariable

312Amostly conserved

528Amostly conserved

549Cmostly conserved

564Gmostly conserved

625Gmostly conserved

627Gmostly conserved

ACATTGTATTTCATTTTTGGATTTTGATCAGGAATACTAGGGTTATCATTTAGTATAATTATTCGTATAGAATTAGGTATACCCGGCAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tenthredo amoenasame family15.2%Ametastegia equisetisame family15.4%Tenthredo zonulasame family15.5%Tenthredo flaveolasame family15.5%Empria longicornissame family15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type119 records

Wild obs. + sensor59

Museum / vouchered60

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 18≤1 km 15≤10 km 11>10 km 2

46 georeferenced · 13 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 6≤1 km 1≤10 km 36

43 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	32
BioFokuslocation not on record	4
ZSMlocation not on record	4
NHMOlocation not on record	4
Stockholm, SE	3
SLU Artdatabankenlocation not on record	3
Institute of Zoology Slovak Academy of Scienceslocation not on record	1
MZLUlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

9 institutions · 53 of 60 vouchered records shown · 7 without an institution code

09Environmental DNA8 detections

Where the DNA of Apethymus apicalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 8.50–14.9

Seasonal swing summer↔winter19.2 °C

Max temp (day)14.1 °C 11.7–19.0

Min temp (night)8.10 °C 5.60–11.0

Precipitation67.7 mm/mo 45.6–97.0

Air humidity63.6 % 61.0–65.0

Moisture balance16.2 mm/mo -14.2–45.3

Vapour deficit475 Pa 391–669

Wind speed2.80 m/s 2.20–3.90

Cloud cover43.9 % 37.7–52.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)