Apechthis rufata

(Gmelin, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Apechthis

At a glance

Occurrence records884

Data sources4

Biological traits0

DNA specimens41

eDNA detections106

Sources4 archives

Databases and archives Apechthis rufata's data was compiled from.

GBIFGlobal Biodiversity Information Facility884 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI106 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF884 records

Environmental DNA5 datasets · 16 countries106 detections

DNA & barcodingBOLD41 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apechthis rufata has left across the world's sequence archives.

At a glance

DNA specimens41

BINs3

Marker genes2

eDNA detections106

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

33Gmostly conserved

78Gmostly conserved

168Tmostly conserved

171Cmostly conserved

180Amostly conserved

192Cmostly conserved

201Cmostly conserved

216Gmostly conserved

219Cmostly conserved

234Cmostly conserved

261Gmostly conserved

262Cmostly conserved

273Amostly conserved

288Tmostly conserved

306Tmostly conserved

315Gmostly conserved

321Gmostly conserved

339Tmostly conserved

342Tmostly conserved

396Tmostly conserved

426Tmostly conserved

538Cmostly conserved

540Tmostly conserved

561Amostly conserved

567Tmostly conserved

573Tmostly conserved

577Cmostly conserved

612Cmostly conserved

624Tmostly conserved

627Amostly conserved

630Amostly conserved

633Tmostly conserved

636Amostly conserved

ATTTTATACTTTATCTTTGGTATATGATCAGGGATAATTGGATCATCTATAAGAATTATTATTCGATTAGAATTAGGGACCCCAGGATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BINs3

Most divergent pair4.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dolichomitus cantillanoisame family9.8%Apechthis quadridentatasame genus10.1%Apechthis ontariosame genus10.2%Syrphophilus bizonariussame family13.1%Scambus buolianaesame family13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type884 records

Wild obs. + sensor749

Museum / vouchered135

Range

Area of Occupancy AOO1 504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 46≤1 km 15≤10 km 384>10 km 2

447 georeferenced · 302 without coordinates

Open the mapobservation + sensor749

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 22≤1 km 15≤10 km 58>10 km 1

96 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	45
SLU Artdatabankenlocation not on record	17
Stockholm, SE	15
Natural History Museum Rotterdamlocation not on record	12
Paris, FR	9
MZLUlocation not on record	9
ZSMlocation not on record	8
Provincia di Livornolocation not on record	5
NHMOlocation not on record	5
Gothenburg, SE	2
Bavarian State Collection of Zoologylocation not on record	2
Zürich, CH	1
MNHWlocation not on record	1
Kuopio, FI	1
Champaign, US	1
neflocation not on record	1

16 institutions · 134 of 135 vouchered records shown · 1 without an institution code

09Environmental DNA106 detections

Where the DNA of Apechthis rufata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found106

Studies independent surveys5

Countries16

Verifiable raw sequence linked56

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 106 detections have coordinates

Open the map16 countries0

1.1. Boreal Forest|1. Forest & WoodlandUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 10.6–19.7

Seasonal swing summer↔winter16.9 °C

Max temp (day)15.1 °C 14.2–23.4

Min temp (night)7.20 °C 6.10–15.4

Precipitation54.4 mm/mo 48.2–94.9

Air humidity60.1 % 57.7–64.8

Moisture balance-56.4 mm/mo -73.6–11.4

Vapour deficit529 Pa 514–872

Wind speed3.80 m/s 2.10–4.30

Cloud cover38.8 % 35.3–49.4

CHELSA 1981–2010, ~9 km grid, at location & month of 102 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)