Apechthis ontario

(Cresson, 1870) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Apechthis

At a glance

Occurrence records268

Data sources6

Biological traits0

DNA specimens104

eDNA detections614

Sources6 archives

Databases and archives Apechthis ontario's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility268 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI614 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics104 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF268 records

Environmental DNA3 datasets · 14 countries614 detections

DNA & barcodingBOLD104 specimens

01Narrative

Apechthis ontario là một loài tò vò trong họ Ichneumonidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding104 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apechthis ontario has left across the world's sequence archives.

At a glance

DNA specimens104

BINs1

Marker genes1

eDNA detections614

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus103 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

34Amostly conserved

68Tmostly conserved

81Cmostly conserved

130Tmostly conserved

133Amostly conserved

139Tmostly conserved

142Cmostly conserved

200Gmostly conserved

283Amostly conserved

340Cmostly conserved

469Cmostly conserved

511Amostly conserved

556Amostly conserved

628Tmostly conserved

634Cmostly conserved

641Cmostly conserved

643Tmostly conserved

TATTTTATATTTTATTTTTGGTTTATGATCAGGAATAATTGGATCATCTATAAGTATTATTATTCGATTAGAATTAGGAACTCCAGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes29

BIN1

Most divergent pair17.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dolichomitus cantillanoisame family9.3%Apechthis rufatasame genus10.2%Diplazon laetatoriussame family10.7%Itoplectis viduatasame family10.8%Tromatobia variabilissame family11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type268 records

Wild obs. + sensor6

Museum / vouchered262

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 1>10 km 2

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 181

181 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence262

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montréal, CA	179
Chicago, US	11
Canadian Forest Service, Atlantic Forestry Centrelocation not on record	3
University of Alberta Museums (UAM)location not on record	2
Toronto, CA	2
Canadian Forest Service, Laurentian Forestry Centrelocation not on record	1

6 institutions · 198 of 262 vouchered records shown · 64 without an institution code

09Environmental DNA614 detections

Where the DNA of Apechthis ontario was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found614

Studies independent surveys3

Countries14

Verifiable raw sequence linked204

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 614 detections have coordinates

Open the map14 countries0

1.1. Boreal Forest|1. Forest & WoodlandTemperate mixed forest1. Forest|1.2 Subarctic Forestalpine snowfields, 10:56am1.1 Boreal Forest1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 8.90–17.7

Seasonal swing summer↔winter25.6 °C

Max temp (day)18.1 °C 13.5–23.2

Min temp (night)10.7 °C 5.50–15.1

Precipitation89.2 mm/mo 51.9–126

Air humidity60.2 % 56.3–62.9

Moisture balance-12.5 mm/mo -69.3–33.2

Vapour deficit662 Pa 471–855

Wind speed2.60 m/s 2.00–5.00

Cloud cover48.0 % 38.6–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 561 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)