Apechthis compunctor

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Apechthis

At a glance

Occurrence records1 504

Data sources3

Biological traits0

DNA specimens21

eDNA detections0

Sources3 archives

Databases and archives Apechthis compunctor's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 504 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 504 records

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT≈404 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apechthis compunctor has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

49Amostly conserved

79Gmostly conserved

103Cmostly conserved

160Gvariable

235Cmostly conserved

430Amostly conserved

481Tmostly conserved

511Amostly conserved

550Amostly conserved

565Avariable

634Tmostly conserved

AATTTTATATTTTATTTTTGGATTCTGATCAGGTATAATTGGATCATCAATAAGAATAATTATTCGATTAGAACTAGGGAATCCTGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes10

BIN1

Most divergent pair1.1%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apechthis annulicornissame genus5.9%Enizemum ornatumsame family10.3%Apechthis quadridentatasame genus10.8%Apechthis ontariosame genus10.9%Itoplectis insignissame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Apechthis compunctor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈404 486 268 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apechthis compunctor0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.9% BUSCO

08Occurrence & distribution

Record type1 504 records

Wild obs. + sensor1 344

Museum / vouchered160

Range

Area of Occupancy AOO3 812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 162≤1 km 79≤10 km 932>10 km 4

1 177 georeferenced · 167 without coordinates

Open the mapobservation + sensor1 344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 36≤1 km 32≤10 km 48>10 km 8

124 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	37
Provincia di Livornolocation not on record	21
SLU Artdatabankenlocation not on record	21
Stockholm, SE	19
Natural History Museum Rotterdamlocation not on record	19
Metsähallituslocation not on record	9
ZSMlocation not on record	4
South Kensington, GB	3
neflocation not on record	3
NHMOlocation not on record	2
Paris, FR	1
NTNU-VMlocation not on record	1
Kuopio, FI	1
BioFokuslocation not on record	1
Gothenburg, SE	1
Champaign, US	1

16 institutions · 144 of 160 vouchered records shown · 16 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apechthis compunctor

At a glance

Sources3 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 504 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 16 geolocated

Record type1 504 records