Apareiodon vittatus

Garavello, 1977 · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Parodontidae/Apareiodon

At a glance

Occurrence records68

Data sources7

Biological traits5

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Apareiodon vittatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Apareiodon vittatus is een straalvinnige vissensoort uit de familie van de rotszalmen (Parodontidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1977 door Garavello.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length14.5 cm

Body mass64.7 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apareiodon vittatus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs5

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P421 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

14Amostly conserved

16Avariable

23Avariable

41Tmostly conserved

45Avariable

55Tmostly conserved

94Amostly conserved

106Avariable

156Gmostly conserved

161Amostly conserved

177Tvariable

192Amostly conserved

195Avariable

198Amostly conserved

209Tmostly conserved

210Amostly conserved

227Cmostly conserved

230Cmostly conserved

233Tmostly conserved

238Cmostly conserved

253Amostly conserved

278Cmostly conserved

284Cmostly conserved

288Cmostly conserved

300Amostly conserved

302Amostly conserved

311Amostly conserved

337Avariable

343Cmostly conserved

350Tvariable

361Tvariable

367Tvariable

370Tmostly conserved

378Cmostly conserved

379Gmostly conserved

386Tvariable

391Avariable

397Avariable

405Tmostly conserved

408Cmostly conserved

411Gvariable

414Avariable

420Avariable

421Cmostly conserved

CTCCTAATTCGAGAAAAGCTGAACCAACCCGGGTCCCTACTGGGAGATGACCATTTTTACAATGTTATCTTTACTGCACATGCTTTTGTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes6

BINs5

Most divergent pair7.1%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apareiodon piracicabaesame genus10.9%Apareiodon cavalcantesame genus14.7%Apareiodon machrisisame genus14.7%Apareiodon affinissame genus15.9%Apareiodon ibitiensissame genus16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor1

Museum / vouchered67

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 67 records without

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UEMlocation not on record	35
Londrina, BR	18
PUC-RSlocation not on record	5
Museu de Zoologia da Universidade de Sao Paulolocation not on record	2
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1

5 institutions · 61 of 67 vouchered records shown · 6 without an institution code

09Environmental DNA6 detections

Where the DNA of Apareiodon vittatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 16.2–16.2

Seasonal swing summer↔winter8.10 °C

Max temp (day)21.7 °C

Min temp (night)12.0 °C

Precipitation171 mm/mo

Air humidity60.6 %

Moisture balance61.5 mm/mo

Vapour deficit731 Pa

Wind speed4.00 m/s

Cloud cover26.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)