Apareiodon machrisi

Travassos, 1957 · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Parodontidae/Apareiodon

At a glance

Occurrence records47

Data sources5

Biological traits4

DNA specimens5

eDNA detections0

Sources5 archives

Databases and archives Apareiodon machrisi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF47 records

DNA & barcodingBOLD5 specimens

01Narrative

Apareiodon machrisi is een straalvinnige vissensoort uit de familie van de rotszalmen (Parodontidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1957 door Travassos.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length7.4 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apareiodon machrisi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P687 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

25Tmostly conserved

637Gmostly conserved

685Cmostly conserved

686Amostly conserved

CACAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTGGGACAGCCCTCAGTCTCCTAATTCGAGCAGAGTTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes3

BIN1

Most divergent pair0.58%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apareiodon piracicabaesame genus5.9%Apareiodon ibitiensissame genus6.9%Apareiodon affinissame genus7.2%Parodon apolinarisame family11.7%Parodon nasussame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type47 records

Wild obs. + sensor1

Museum / vouchered46

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UEMlocation not on record	13
Museu de Zoologia da Universidade de Sao Paulolocation not on record	10
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	8
PUC-RSlocation not on record	7
UFMSlocation not on record	2
CASlocation not on record	2
UNICAMPlocation not on record	2
USP-RPlocation not on record	2

8 institutions · 46 of 46 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)