Apamea verbascoides

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records317

Data sources7

Biological traits0

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Apamea verbascoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF317 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Apamea verbascoides, the boreal apamea or mullein apamea, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is native to North America, where it is found from Saskatchewan to Newfoundland and Labrador and south to North Carolina.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea verbascoides has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Amostly conserved

5Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

12Tmostly conserved

13Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

23Amostly conserved

24Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

31Amostly conserved

34Tmostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Gmostly conserved

41Gmostly conserved

42Gmostly conserved

45Cmostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

52Amostly conserved

54Gmostly conserved

56Tmostly conserved

57Tmostly conserved

59Cmostly conserved

60Tmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

71Gmostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

79Tmostly conserved

541Amostly conserved

601Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACTTCTTTAAGTTTACTTATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea nigriorsame genus5.0%Apamea cariosasame genus5.5%Apamea quinterisame genus5.5%Apamea vulgarissame genus5.8%Apamea ferragosame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type317 records

Wild obs. + sensor98

Museum / vouchered219

Range

Area of Occupancy AOO756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 59≤1 km 12≤10 km 5>10 km 10

86 georeferenced · 12 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 3≤1 km 46≤10 km 112>10 km 11

172 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	128
East Lansing, US	29
New Haven, US	18
St. Paul, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
North Carolina State University Insect Museumlocation not on record	4
Brussels, BE	3
Champaign, US	3
University of Alberta Museums (UAM)location not on record	2
Colorado State Universitylocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
RBINS-Scientific Heritagelocation not on record	2
Philadelphia, US	1
Vernal, US	1
UDlocation not on record	1
Toronto, CA	1
SOVTlocation not on record	1
Saint John, CA	1

18 institutions · 208 of 219 vouchered records shown · 11 without an institution code

09Environmental DNA13 detections

Where the DNA of Apamea verbascoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 17.8–19.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.4 °C 21.8–24.5

Min temp (night)14.9 °C 13.4–15.7

Precipitation123 mm/mo 83.4–178

Air humidity60.2 % 57.5–64.5

Moisture balance-9.50 mm/mo -59.3–34.5

Vapour deficit833 Pa 698–934

Wind speed3.00 m/s 2.50–3.40

Cloud cover43.8 % 27.0–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)