Apamea vulgaris

Grote & Robinson, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records118

Data sources7

Biological traits0

DNA specimens19

eDNA detections20

Sources7 archives

Databases and archives Apamea vulgaris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility118 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF118 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD19 specimens

01Narrative

Apamea vulgaris (common apamea) is a moth of the family Noctuidae. It is found from Nova Scotia to Kentucky, and west to Kansas. It has been recorded from Ontario, New York, Pennsylvania and Maryland.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea vulgaris has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.12%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 4 variable positions, in barcode order

73Amostly conserved

208Gmostly conserved

544Gmostly conserved

616Cmostly conserved

AACATTATATTTTATTTTTGGGATTTGAGCAGGTATGGTAGGAACTTCTTTAAGTCTACTTATTCGAGCTGAATTGGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea nigriorsame genus4.7%Apamea quinterisame genus5.2%Apamea cristatasame genus5.5%Apamea acerasame genus5.8%Apamea alticolasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type118 records

Wild obs. + sensor15

Museum / vouchered103

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 2≤1 km 4≤10 km 4>10 km 1

11 georeferenced · 4 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 21≤10 km 38>10 km 6

65 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	28
East Lansing, US	20
North Carolina State University Insect Museumlocation not on record	19
King Saud Universitylocation not on record	11
Cleveland Museum of Natural History, OH (CLEV)location not on record	11
OSUClocation not on record	3
CUlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
UKY-HIClocation not on record	1
SOVTlocation not on record	1

10 institutions · 97 of 103 vouchered records shown · 6 without an institution code

09Environmental DNA20 detections

Where the DNA of Apamea vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

ForestGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 15.2–22.7

Seasonal swing summer↔winter26.0 °C

Max temp (day)22.6 °C 19.7–26.2

Min temp (night)13.4 °C 10.5–19.6

Precipitation104 mm/mo 81.0–142

Air humidity59.3 % 57.5–62.5

Moisture balance-55.5 mm/mo -68.8–14.3

Vapour deficit839 Pa 680–1,151

Wind speed3.10 m/s 1.80–3.90

Cloud cover39.5 % 35.9–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)