Apamea plutonia

Grote, 1883 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records153

Data sources7

Biological traits0

DNA specimens15

eDNA detections15

Sources7 archives

Databases and archives Apamea plutonia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF153 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Apamea plutonia, the dusky Quaker or dusky apamea, is a moth of the family Noctuidae. The species was first described by Augustus Radcliffe Grote in 1883. It is native to northern North America, where it occurs across the boreal regions, with some occurrences from as far south as New Mexico and Pennsylvania."Apamea plutonia (Grote, 1883)". Pacific Northwest Moths. Retrieved November 15, 2020. The forewing length is 16 to 17 millimeters, and the wings are very dark brown, nearly black. The cutworm larva feeds on grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea plutonia has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

22Amostly conserved

61Amostly conserved

76Amostly conserved

91Tmostly conserved

217Amostly conserved

265Gmostly conserved

268Amostly conserved

319Avariable

511Amostly conserved

541Gmostly conserved

559Amostly conserved

613Tmostly conserved

614Gmostly conserved

615Amostly conserved

616Tmostly conserved

618Cmostly conserved

619Tmostly conserved

620Gmostly conserved

621Cmostly conserved

624Gmostly conserved

625Amostly conserved

627Gmostly conserved

628Amostly conserved

630Gmostly conserved

631Amostly conserved

632Gmostly conserved

633Amostly conserved

634Tmostly conserved

636Cmostly conserved

638Amostly conserved

642Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Tmostly conserved

647Cmostly conserved

649Amostly conserved

650Cmostly conserved

651Amostly conserved

654Tmostly conserved

655Amostly conserved

AACATTATATTTTATTTTTGGAATTTGGGCTGGGATAGTTGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea rubrirenasame genus6.2%Leucochlaena muscosasame family6.2%Apamea acerasame genus6.4%Apamea maximasame genus6.4%Apamea ancepssame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type153 records

Wild obs. + sensor30

Museum / vouchered123

Range

Area of Occupancy AOO376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 11≤1 km 7≤10 km 7

25 georeferenced · 5 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 12≤1 km 23≤10 km 23>10 km 2

60 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	23
East Lansing, US	22
University of Alberta Museums (UAM)location not on record	21
Colorado State Universitylocation not on record	10
Oregon State Arthropod Collectionlocation not on record	10
Royal Saskatchewan Museumlocation not on record	7
St. Paul, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Denver, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Essig Museum of Entomologylocation not on record	2
WWUlocation not on record	1

12 institutions · 114 of 123 vouchered records shown · 9 without an institution code

09Environmental DNA15 detections

Where the DNA of Apamea plutonia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

Temperate mixed forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 13.6–18.0

Seasonal swing summer↔winter26.1 °C

Max temp (day)22.5 °C 17.4–23.7

Min temp (night)11.9 °C 6.50–13.4

Precipitation81.6 mm/mo 75.6–91.9

Air humidity57.3 % 49.5–60.0

Moisture balance-57.4 mm/mo -86.7–-26.0

Vapour deficit844 Pa 613–888

Wind speed2.90 m/s 2.40–3.80

Cloud cover40.4 % 24.3–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)