Apamea indocilis

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records180

Data sources7

Biological traits0

DNA specimens42

eDNA detections43

Sources7 archives

Databases and archives Apamea indocilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility180 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF180 records

Environmental DNA1 datasets · 2 countries43 detections

DNA & barcodingBOLD42 specimens

01Narrative

Apamea indocilis, the ignorant apamea, is a moth of the family Noctuidae. It is native to North America, where it is distributed throughout southern Canada and the northern United States. In the east its range extends from Newfoundland to South Carolina. In the west it occurs as far south as San Francisco Bay and in the Rocky Mountains to New Mexico.Apamea indocilis. Pacific Northwest Moths. The forewings are 15 to 19 millimeters long. The moth is generally brown or yellowish tan, but there are three morphs: one lighter mottled tan form and two forms covered with darker markings. The larva is a cutworm that feeds on grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea indocilis has left across the world's sequence archives.

At a glance

DNA specimens42

BINs2

Marker genes1

eDNA detections43

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

22Amostly conserved

40Avariable

142Tvariable

160Avariable

169Tvariable

217Amostly conserved

361Cvariable

379Tvariable

622Gvariable

628Avariable

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTTTACTAATTCGAGCCGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes6

BINs2

Most divergent pair5.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea remissasame genus2.0%Apamea impulsasame genus3.8%Apamea oblongasame genus3.8%Arenostola unicolorsame family3.8%Apamea kuusamoensissame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type180 records

Wild obs. + sensor42

Museum / vouchered138

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 22≤1 km 5≤10 km 4>10 km 3

34 georeferenced · 8 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 15≤1 km 14≤10 km 49>10 km 3

81 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	38
East Lansing, US	19
Colorado State Universitylocation not on record	15
St. Paul, US	12
Oregon State Arthropod Collectionlocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Toronto, CA	3
Edmonton, CA	2
Royal Saskatchewan Museumlocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
Brussels, BE	2
Cambridge, US	2
University of California, Davislocation not on record	1
WWUlocation not on record	1
Vernal, US	1
CUlocation not on record	1

17 institutions · 118 of 138 vouchered records shown · 20 without an institution code

09Environmental DNA43 detections

Where the DNA of Apamea indocilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest5. Wetlands (inland)Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 11.0–19.1

Seasonal swing summer↔winter20.0 °C

Max temp (day)21.0 °C 16.5–25.0

Min temp (night)12.2 °C 7.80–14.9

Precipitation76.9 mm/mo 34.8–127

Air humidity60.7 % 54.2–64.1

Moisture balance-53.6 mm/mo -110–22.5

Vapour deficit699 Pa 556–929

Wind speed3.80 m/s 1.80–4.40

Cloud cover34.9 % 27.5–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)