Apamea alia

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records614

Data sources7

Biological traits0

DNA specimens52

eDNA detections50

Sources7 archives

Databases and archives Apamea alia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility614 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF614 records

Environmental DNA1 datasets · 2 countries50 detections

DNA & barcodingBOLD52 specimens

01Narrative

Apamea alia is a moth of the family Noctuidae. It is found in eastern and western regions of North America. The wingspan is about 39 mm. The moth flies from June to August depending on the location. The larva feeds on various grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea alia has left across the world's sequence archives.

At a glance

DNA specimens52

BINs2

Marker genes1

eDNA detections50

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

82Tmostly conserved

217Amostly conserved

577Avariable

628Amostly conserved

634Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACTTCTTTAAGATTACTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes8

BINs2

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arenostola unicolorsame family3.0%Apamea ferragosame genus3.2%Apamea cogitatasame genus3.8%Leucochlaena muscosasame family3.8%Lenisa geminipunctasame family4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type614 records

Wild obs. + sensor112

Museum / vouchered502

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 60≤1 km 16≤10 km 11>10 km 8

95 georeferenced · 17 without coordinates

Open the mapobservation + sensor112

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 67≤1 km 105≤10 km 90>10 km 15

277 georeferenced · 225 without coordinates

Open the institutions mapphysical evidence502

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	126
East Lansing, US	66
University of Alberta Museums (UAM)location not on record	65
New Haven, US	49
Oregon State Arthropod Collectionlocation not on record	44
University of Guelph, Centre for Biodiversity Genomicslocation not on record	23
Edmonton, CA	19
Denver, US	12
Royal Saskatchewan Museumlocation not on record	12
Cleveland Museum of Natural History, OH (CLEV)location not on record	12
St. Paul, US	10
Vernal, US	4
Brussels, BE	4
RBINS-Scientific Heritagelocation not on record	3
PUC-RSlocation not on record	3
National Institute of Biological Resourceslocation not on record	2
WWUlocation not on record	2
University of California, Davislocation not on record	2
KWPlocation not on record	2
Cambridge, US	1
SOVTlocation not on record	1
MZLUlocation not on record	1

22 institutions · 463 of 502 vouchered records shown · 39 without an institution code

09Environmental DNA50 detections

Where the DNA of Apamea alia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map2 countries0

17. OtherTemperate mixed forestRiparian Zone1. Forest & Woodland|1.1. Boreal Forest14. Artificial - Terrestrial|14.1 Arable Land1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 12.6–19.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)21.7 °C 15.1–25.7

Min temp (night)11.6 °C 7.30–14.1

Precipitation73.2 mm/mo 36.2–104

Air humidity57.0 % 51.3–60.5

Moisture balance-61.2 mm/mo -94.9–-6.90

Vapour deficit791 Pa 590–1,027

Wind speed2.60 m/s 1.50–3.90

Cloud cover40.9 % 33.4–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)