Apamea albina

Grote, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records36

Data sources7

Biological traits0

DNA specimens7

eDNA detections9

Sources7 archives

Databases and archives Apamea albina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF36 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD7 specimens

01Narrative

Apamea albina is a moth of the family Noctuidae. It is native to California and Oregon in the United States. It lives in forests and oak savanna on serpentine soils.Apamea albina. Pacific Northwest Moths. The moth has a forewing length of 20 to 23 millimeters. It is red-brown in color with areas of white, black, and blue-gray. The hindwing is yellow-gray. The head and thorax are dark brown.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea albina has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

37Avariable

85Tmostly conserved

199Gvariable

217Gmostly conserved

232Amostly conserved

286Gvariable

325Avariable

478Cvariable

631Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTTATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes5

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea lintnerisame genus6.0%Apamea contradictasame genus6.4%Apamea oblongasame genus6.5%Lenisa geminipunctasame family6.7%Gortyna boreliisame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type36 records

Wild obs. + sensor11

Museum / vouchered25

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 1≤10 km 3

9 georeferenced · 2 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 2≤1 km 1≤10 km 10>10 km 1

14 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	8
University of Alberta Museums (UAM)location not on record	8
New Haven, US	3
San Francisco, US	1
Oregon State Arthropod Collectionlocation not on record	1
St. Paul, US	1
Colorado State Universitylocation not on record	1

7 institutions · 23 of 25 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Apamea albina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 13.6–17.1

Seasonal swing summer↔winter7.40 °C

Max temp (day)21.7 °C 18.7–23.9

Min temp (night)9.40 °C 8.00–11.5

Precipitation9.70 mm/mo 3.30–22.9

Air humidity60.7 % 44.4–61.4

Moisture balance-128 mm/mo -155–-126

Vapour deficit703 Pa 599–1,001

Wind speed2.70 m/s 2.20–2.80

Cloud cover33.5 % 22.9–35.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)