Antispila freemani

Lafontaine, 1973 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Heliozelidae/Antispila

At a glance

Occurrence records127

Data sources7

Biological traits0

DNA specimens93

eDNA detections100

Sources7 archives

Databases and archives Antispila freemani's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility127 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI100 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics93 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF127 records

Environmental DNA1 datasets · 4 countries100 detections

DNA & barcodingBOLD93 specimens

01Narrative

Antispila freemani is a moth of the family Heliozelidae. It was described by J. Donald Lafontaine in 1973. It is found in North America, including Ontario and British Columbia. The larvae feed on Cornus canadensis.Host records for Lepidoptera reared in Eastern North America

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding93 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antispila freemani has left across the world's sequence archives.

At a glance

DNA specimens93

BINs1

Marker genes1

eDNA detections100

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

228Amostly conserved

234Cvariable

265Cmostly conserved

336Avariable

369Avariable

432Gmostly conserved

472Gmostly conserved

498Tmostly conserved

532Tvariable

549Tmostly conserved

603Amostly conserved

618Gmostly conserved

ACTCTATATTTTATTTTTGGAATTTGAGCAGGTTTAATTGGAACTTCTATAAGACTTTTAATTCGAGCTGAATTAGGAATACCTGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes11

BIN1

Most divergent pair1.1%

OceaniaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antispila cornifoliellasame genus12.3%Victoria fifensissame order15.1%Victoria eremitasame order15.4%Caryocolum messnerisame order15.7%Gnorimoschema albimarginellasame order16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type127 records

Wild obs. + sensor118

Museum / vouchered9

Range

Area of Occupancy AOO424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 44≤1 km 16≤10 km 6>10 km 8

74 georeferenced · 44 without coordinates

Open the mapobservation + sensor118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1
East Lansing, US	1

3 institutions · 4 of 9 vouchered records shown · 5 without an institution code

09Environmental DNA100 detections

Where the DNA of Antispila freemani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found100

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 100 detections have coordinates

Open the map4 countries0

GrasslandMixed habitatMixed HabitatWetlandForest1. Forest & Woodland | 1.9. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 14.6–23.1

Seasonal swing summer↔winter25.2 °C

Max temp (day)19.2 °C 17.9–25.5

Min temp (night)13.6 °C 11.7–19.9

Precipitation107 mm/mo 81.6–129

Air humidity61.1 % 58.2–64.4

Moisture balance-9.90 mm/mo -97.2–35.2

Vapour deficit687 Pa 586–1,086

Wind speed3.20 m/s 2.40–6.70

Cloud cover49.0 % 36.0–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 96 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)