Antispila cornifoliella

Clemens, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Heliozelidae/Antispila

At a glance

Occurrence records80

Data sources6

Biological traits0

DNA specimens23

eDNA detections23

Sources6 archives

Databases and archives Antispila cornifoliella's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility80 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF80 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

Antispila cornifoliella is a moth of the family Heliozelidae. It is found in North America, including Alberta, Maryland, Ohio, Ontario, Pennsylvania and Quebec.mothphotographersgroup The larvae feed on Cornus species. They mine the leaves of their host plant,microleps.org typically in September. In the larva, the head and shield are dark brown. Most of the rest of its body is white. For adults, the body is mostly dark brown, with purplish brown hind wings.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antispila cornifoliella has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes2

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

28Amostly conserved

70Tmostly conserved

73Amostly conserved

82Gmostly conserved

181Tmostly conserved

208Gmostly conserved

238Cvariable

262Amostly conserved

298Tmostly conserved

319Cmostly conserved

346Tmostly conserved

433Gvariable

475Amostly conserved

490Tmostly conserved

517Amostly conserved

541Amostly conserved

547Amostly conserved

565Amostly conserved

574Amostly conserved

601Tmostly conserved

616Cmostly conserved

620Amostly conserved

621Tmostly conserved

622Avariable

628Gmostly conserved

645Amostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGATTAATTGGAACTTCTATAAGTCTTTTAATTCGTGCTGAACTAGGAATGCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes7

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Opisthoxia croesariasame order14.3%Comostolopsis simplexsame order14.6%Phrygionis flavilimessame order14.7%Eumelea rubrifusasame order15.0%Bulonga griseosericeasame order15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type80 records

Wild obs. + sensor49

Museum / vouchered31

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 19≤1 km 6≤10 km 5>10 km 6

36 georeferenced · 13 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 8

8 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
East Lansing, US	8
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

3 institutions · 17 of 31 vouchered records shown · 14 without an institution code

09Environmental DNA23 detections

Where the DNA of Antispila cornifoliella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 14.5–21.0

Seasonal swing summer↔winter24.1 °C

Max temp (day)22.2 °C 18.5–24.9

Min temp (night)14.2 °C 10.0–17.8

Precipitation106 mm/mo 79.7–118

Air humidity60.5 % 57.7–66.7

Moisture balance-9.50 mm/mo

Vapour deficit800 Pa 608–1,018

Wind speed3.00 m/s

Cloud cover45.9 % 35.4–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)