Anticlea multiferata

(Walker) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Anticlea

At a glance

Occurrence records1 012

Data sources6

Biological traits0

DNA specimens61

eDNA detections59

Sources6 archives

Databases and archives Anticlea multiferata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 012 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics61 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 012 records

Environmental DNA1 datasets · 2 countries59 detections

DNA & barcodingBOLD61 specimens

01Narrative

Anticlea multiferata, the many-lined carpet, is a moth of the family Geometridae. The species was first described by Francis Walker in 1863. It is known from all of North America, including Alaska and the Arctic regions of Canada. The wingspan is 19–25 mm. The forewings are brownish maroon with many fine parallel yellowish lines. Adults are on wing from April to August, although only in April and May in the south and from May to July in the north. The larvae feed on Epilobium species and Polygonum aviculare.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding61 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anticlea multiferata has left across the world's sequence archives.

At a glance

DNA specimens61

BINs1

Marker genes3

eDNA detections59

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

40Cmostly conserved

79Amostly conserved

106Tmostly conserved

217Amostly conserved

307Gmostly conserved

316Amostly conserved

382Cmostly conserved

397Cmostly conserved

412Gvariable

442Cmostly conserved

469Amostly conserved

523Tmostly conserved

577Gmostly conserved

604Amostly conserved

616Tmostly conserved

619Cmostly conserved

625Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCCGGTATAATCGGAACTTCATTAAGACTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes22

BIN1

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eois spnrsame family7.8%Anticlea pectinatasame genus8.0%Photoscotosia multilineasame family8.2%Hydriomena furcatasame family8.4%Asthenotricha lophopteratasame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type1 012 records

Wild obs. + sensor791

Museum / vouchered221

Range

Area of Occupancy AOO2 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 462≤1 km 94≤10 km 39>10 km 80

675 georeferenced · 116 without coordinates

Open the mapobservation + sensor791

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 5≤1 km 31≤10 km 56>10 km 14

106 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence221

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	55
University of Alberta Museums (UAM)location not on record	32
East Lansing, US	30
University of Guelph, Centre for Biodiversity Genomicslocation not on record	21
Colorado State Universitylocation not on record	6
Cornell University Insect Collectionlocation not on record	5
Royal Saskatchewan Museumlocation not on record	5
Georgia Museum of Natural Historylocation not on record	5
Mississippi State, US	4
Edmonton, CA	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
St. Paul, US	3
OSUClocation not on record	2
Vernal, US	2
Centre for Biodiversity Genomicslocation not on record	2
Toronto, CA	2
Cambridge, US	1
King Saud Universitylocation not on record	1
Natural History Museum of Utahlocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

20 institutions · 185 of 221 vouchered records shown · 36 without an institution code

09Environmental DNA59 detections

Where the DNA of Anticlea multiferata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found59

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 59 detections have coordinates

Open the map2 countries0

Temperate mixed forest1. Forest & Woodland | 1.1 Boreal Forest1. Forest & Woodland|1.1. Boreal Forest1. Forest & WoodlandGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 11.6–20.8

Seasonal swing summer↔winter26.4 °C

Max temp (day)20.9 °C 16.2–24.2

Min temp (night)11.1 °C 7.10–15.0

Precipitation85.8 mm/mo 52.8–114

Air humidity57.0 % 52.9–61.1

Moisture balance-52.2 mm/mo -97.2–0.1

Vapour deficit741 Pa 551–1,086

Wind speed2.90 m/s 1.10–6.10

Cloud cover42.1 % 36.5–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anticlea multiferata

At a glance

Sources6 archives

At a glance

Record type1 012 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 012 records