Anticarsia anisospila

Walker, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anticarsia

At a glance

Occurrence records90

Data sources6

Biological traits0

DNA specimens10

eDNA detections10

Sources6 archives

Databases and archives Anticarsia anisospila's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility90 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF90 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Anticarsia anisospila is een vlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1869 door Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anticarsia anisospila has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.4%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 62 variable positions, in barcode order

37Amostly conserved

52Amostly conserved

79Cmostly conserved

82Cmostly conserved

85Tmostly conserved

88Tmostly conserved

112Cmostly conserved

118Cmostly conserved

124Amostly conserved

154Cmostly conserved

166Amostly conserved

175Tmostly conserved

178Tmostly conserved

187Amostly conserved

197Gmostly conserved

202Tmostly conserved

205Amostly conserved

220Tmostly conserved

232Cmostly conserved

253Tmostly conserved

260Cmostly conserved

262Tmostly conserved

265Gmostly conserved

268Cmostly conserved

271Tmostly conserved

280Amostly conserved

281Tmostly conserved

283Amostly conserved

289Tmostly conserved

304Tmostly conserved

310Cmostly conserved

340Cmostly conserved

344Cmostly conserved

346Tmostly conserved

349Tmostly conserved

373Tmostly conserved

397Cmostly conserved

400Cmostly conserved

409Gvariable

436Cmostly conserved

439Tmostly conserved

472Tmostly conserved

476Cmostly conserved

478Tmostly conserved

481Tmostly conserved

491Tmostly conserved

523Tmostly conserved

526Tmostly conserved

536Cmostly conserved

538Tmostly conserved

547Gmostly conserved

550Tmostly conserved

553Amostly conserved

554Cmostly conserved

583Tmostly conserved

586Tmostly conserved

598Cmostly conserved

610Cmostly conserved

613Cmostly conserved

619Amostly conserved

622Amostly conserved

625Amostly conserved

TTTATATTTTATTTTTGGTATCTGAGCAGGTATAGTAGGAACCTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGTTCTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trogogonia abruptasame family8.0%Hecatera corsicasame order8.0%Agrotis porphyricollissame order8.1%Ophyx loxographasame family8.3%Simplicia erebinasame family8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type90 records

Wild obs. + sensor23

Museum / vouchered67

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 12≤1 km 3>10 km 3

18 georeferenced · 5 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	60
Paris, FR	1
Museum national d'Histoire naturellelocation not on record	1
Area de Conservacion Guanacastelocation not on record	1
St. Paul, US	1

5 institutions · 64 of 67 vouchered records shown · 3 without an institution code

09Environmental DNA10 detections

Where the DNA of Anticarsia anisospila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.9. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 10.4–22.5

Seasonal swing summer↔winter2.90 °C

Max temp (day)23.5 °C 14.2–26.1

Min temp (night)16.7 °C 7.10–19.1

Precipitation93.0 mm/mo 89.3–319

Air humidity67.4 % 67.3–72.0

Moisture balance28.8 mm/mo 18.5–200

Vapour deficit755 Pa 352–909

Wind speed1.00 m/s 0.5–1.60

Cloud cover33.7 % 32.9–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)