Antiblemma tuva

Schaus, 1911 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Antiblemma

At a glance

Occurrence records25

Data sources4

Biological traits0

DNA specimens45

eDNA detections50

Sources4 archives

Databases and archives Antiblemma tuva's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 3 countries50 detections

DNA & barcodingBOLD45 specimens

01Narrative

Antiblemma tuva is een vlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1911 door Schaus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiblemma tuva has left across the world's sequence archives.

At a glance

DNA specimens45

BINs1

Marker genes1

eDNA detections50

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

10Cvariable

202Tmostly conserved

274Tmostly conserved

340Tmostly conserved

520Gmostly conserved

TACTTTATACTTTATTTTTGGTATCTGAGCTGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAACACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes9

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antiblemma anguineasame genus7.8%Antiblemma herilissame genus8.2%Antiblemma sufficienssame genus8.4%Condica ortasame order8.5%Ramadasa pavosame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Museum / vouchered25

Range

Area of Occupancy AOO64 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	21
University of Pennsylvanialocation not on record	2

2 institutions · 23 of 25 vouchered records shown · 2 without an institution code

09Environmental DNA50 detections

Where the DNA of Antiblemma tuva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.9. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 20.6–25.2

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.2 °C 22.7–29.3

Min temp (night)21.2 °C 18.0–21.8

Precipitation302 mm/mo 48.7–422

Air humidity69.0 % 63.1–70.8

Moisture balance151 mm/mo -107–298

Vapour deficit876 Pa 692–1,174

Wind speed2.60 m/s 0.7–5.60

Cloud cover33.8 % 13.5–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)