Antiblemma herilis

Schaus, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Antiblemma

At a glance

Occurrence records28

Data sources4

Biological traits0

DNA specimens34

eDNA detections34

Sources4 archives

Databases and archives Antiblemma herilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 1 countries34 detections

DNA & barcodingBOLD34 specimens

01Narrative

Antiblemma herilis is een vlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1913 door Schaus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiblemma herilis has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections34

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

298Amostly conserved

TACTTTATATTTTATTTTTGGAATCTGAGCTGGTATAGTTGGAACATCATTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antiblemma rubidasame genus6.7%Antiblemma pirasame genus7.1%Antiblemma borregasame genus7.3%Antiblemma lacteigerasame genus7.4%Antiblemma strigatulasame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor5

Museum / vouchered23

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	23

1 institutions · 23 of 23 vouchered records shown

09Environmental DNA34 detections

Where the DNA of Antiblemma herilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 22.4–24.5

Seasonal swing summer↔winter2.50 °C

Max temp (day)26.7 °C 26.2–27.9

Min temp (night)21.0 °C 18.7–21.8

Precipitation187 mm/mo 83.3–404

Air humidity68.4 % 65.7–73.3

Moisture balance53.7 mm/mo -44.1–272

Vapour deficit868 Pa 748–1,062

Wind speed2.30 m/s 0.6–4.10

Cloud cover25.3 % 13.4–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)