Antiblemma laranda

Druce, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Antiblemma

At a glance

Occurrence records25

Data sources4

Biological traits0

DNA specimens26

eDNA detections26

Sources4 archives

Databases and archives Antiblemma laranda's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 1 countries26 detections

DNA & barcodingBOLD26 specimens

01Narrative

Antiblemma laranda is een vlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1890 door Druce.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antiblemma laranda has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections26

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes2

BIN1

Most divergent pair0.15%

TACTTTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGTACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antiblemma anguineasame genus6.2%Antiblemma lacteigerasame genus7.1%Antiblemma leucocymasame genus7.4%Antiblemma rubidasame genus7.5%Antiblemma herilissame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor1

Museum / vouchered24

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	21
Ciudad de México, MX	2
University of Pennsylvanialocation not on record	1

3 institutions · 24 of 24 vouchered records shown

09Environmental DNA26 detections

Where the DNA of Antiblemma laranda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 24.0–25.5

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.2 °C 26.9–29.8

Min temp (night)21.7 °C 21.1–22.1

Precipitation302 mm/mo 137–415

Air humidity69.1 % 61.9–73.0

Moisture balance151 mm/mo -24.9–288

Vapour deficit943 Pa 746–1,238

Wind speed3.30 m/s 1.80–4.20

Cloud cover38.7 % 23.3–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)