Anthrenocerus australis

(Hope, 1843) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenocerus

At a glance

Occurrence records762

Data sources7

Biological traits0

DNA specimens21

eDNA detections26

Sources7 archives

Databases and archives Anthrenocerus australis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility762 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF762 records

Environmental DNA2 datasets · 6 countries26 detections

DNA & barcodingBOLD21 specimens

01Narrative

Anthrenocerus australis is a species of beetle belonging to the Dermestidae family.Anthrenocerus australis. Atlas of Living Australia. It is commonly known as the Australian carpet beetle and is one of the most researched of the thirty-one species in the Anthrenocerus genus. This is generally attributed to its prevalence throughout Australia and New Zealand and the negative economic and agricultural impact it has as a pest.Herrmann, A., & Háva, J. (2007). The first record of the Australian immigrant Anthrenocerus australis (Hope, 1843)(Coleoptera: Dermestidae) from Italy. Gredleriana 7, 412-413. It is the larvae that causes damage to products, not the adult beetle. The total life cycle of this insect is around three years, most of which is spent as a larva. Once the beetle reaches maturity, it only lives for between two and six weeks.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenocerus australis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections26

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

70Tmostly conserved

88Amostly conserved

103Cmostly conserved

190Amostly conserved

256Amostly conserved

328Gmostly conserved

530Cmostly conserved

556Avariable

577Gmostly conserved

653Cmostly conserved

655Cvariable

AACATTATATTTTATTTTCGGAGCATGAGCAGGAATAACAGGAACATCCCTAAGAATATTAATTCGAACTGAACTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes10

BIN1

Most divergent pair2.1%

EuropeOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sefrania bleuseisame family14.6%Anthrenus festivussame family14.7%Reesa vespulaesame family15.0%Megatoma perversasame family15.0%Dermestes tessellatocollissame family15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type762 records

Wild obs. + sensor669

Museum / vouchered92

Other1

Origin

Introduced19

Range

Area of Occupancy AOO1 880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 276≤1 km 99≤10 km 144>10 km 65

584 georeferenced · 85 without coordinates

Open the mapobservation + sensor669

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 9≤1 km 6≤10 km 22>10 km 5

42 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	25
Auckland, NZ	23
New Zealand Arthropod Collectionlocation not on record	14
Tilburg, NL	7
Dhaka, BD	4
Natural History Museum Rotterdamlocation not on record	3
South Kensington, GB	3
ZSMlocation not on record	2
Geneva, CH	2
neflocation not on record	1

10 institutions · 84 of 92 vouchered records shown · 8 without an institution code

09Environmental DNA26 detections

Where the DNA of Anthrenocerus australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys2

Countries6

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 3.50–16.9

Seasonal swing summer↔winter17.6 °C

Max temp (day)15.0 °C 7.00–21.3

Min temp (night)7.40 °C -0.2–13.2

Precipitation65.3 mm/mo 51.5–90.2

Air humidity61.4 % 57.7–64.3

Moisture balance-8.20 mm/mo -46.5–21.6

Vapour deficit555 Pa 294–823

Wind speed2.70 m/s 2.30–4.70

Cloud cover42.2 % 34.1–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)