Anthopleura xanthogrammica

(Brandt, 1835) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Actiniaria/Actiniidae/Anthopleura

At a glance

Occurrence records33 173

Data sources13

Biological traits5

DNA specimens45

eDNA detections1

Sources13 archives

Databases and archives Anthopleura xanthogrammica's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 845 records↗

OBISOcean Biodiversity Information System8 328 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources5 traits

Chemical compositionNPASS76 compounds

Occurrence & distributionGBIF · OBIS33 173 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD45 specimens

Genome at a glanceGoaT · NCBI≈290 Mbp

01Narrative

Spectacular lineup of Giant Greens at Hazard Reef, Montana de Oro State Park. Channel is about a foot (30cm) wide. It drains a large tidepool which supplies abundant good food. Giant Greens at New England Aquarium Anthopleura xanthogrammica, or the giant green anemone, is a species of intertidal sea anemone of the family Actiniidae. Other common names for this anemone include green surf anemone, giant green sea anemone, green anemone, giant tidepool anemone, anemone, and rough anemone.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length30 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max30 m

Depth min0 m

03Chemical composition76 compounds

Compounds documented for Anthopleura xanthogrammica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Gallotannins13

Flavonols12

Friedelane triterpenoids7

Oleanane triterpenoids3

Isocoumarins3

Documented compounds76 total

Tissue Source Quantified only

Compound	Amount	Source
(10S,11R,29R,31R,32R)-3,4,5,16,17,18,21,22,23,31,36,37,38-tridecahydroxy-9,12,27,30,33-pentaoxaheptacyclo[33.3.1.02,7.010,32.011,29.014,19.020,25]nonatriaconta-1(39),2,4,6,14,16,18,20,22,24,35,37-dodecaene-8,13,26,34-tetrone	present	NPASS
(1R,2R,20R,37R,44S,45R,49S,50S,56S)-45-(3,4-dihydroxyphenyl)-7,8,9,12,13,14,25,26,27,30,31,32,35,41,44-pentadecahydroxy-3,18,21,38,46,51,54-heptaoxadodecacyclo[27.21.3.334,50.02,20.05,10.011,16.023,28.033,53.037,49.039,48.042,47.037,56]hexapentaconta-5,7,9,11,13,15,23,25,27,29(53),30,32,34,39(48),40,42(47)-hexadecaene-4,17,22,36,52,55-hexone	present	NPASS
(1R,2R,20R,42R,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(1R,2R,20R,42S,46S)-46-[(2R,3S)-2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-3,4-dihydro-2H-chromen-6-yl]-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37-pentadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(1R,2R,20S,42S,46S)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bS)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	NPASS
(2R,3S)-2,3-bis(1,3-benzodioxol-5-ylmethyl)butane-1,4-diol	present	NPASS
(3S,4R,4aS,6aS,6aS,6bR,8aR,12aR,14aS,14bS)-3-hydroxy-4,4a,6a,6b,8a,11,11,14a-octamethyl-3,4,5,6,6a,7,8,9,10,12,12a,13,14,14b-tetradecahydro-1H-picen-2-one	present	NPASS
(4aR,6S,8aR)-6-[(1S)-1-hydroxyethyl]-6,8a-dihydro-4aH-pyrano[3,2-b]pyran-2-one	present	NPASS
(4aR,6S,8aS)-6-[(1S)-1-hydroxyethyl]-6,8a-dihydro-4aH-pyrano[3,2-b]pyran-2-one	present	NPASS

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthopleura xanthogrammica has left across the world's sequence archives.

At a glance

DNA specimens45

BINs1

Marker genes2

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.2%

Haplotypes2

BIN1

Most divergent pair1.7%

Where individuals differ — all 11 variable positions, in barcode order

73Avariable

103Tvariable

202Gvariable

217Cvariable

247Tvariable

274Cvariable

319Avariable

325Cvariable

355Cvariable

373Cvariable

634Cvariable

AACTTTATATTTAGTGTTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAATTGTCTGCCCCTGGTAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anemonia alicemartinaesame family3.2%Urticinopsis antarcticasame family3.8%Bolocera tuediaesame family4.0%Urticina felinasame family4.6%Urticina crassicornissame family4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_066051 ↗ · 13 protein · 2 tRNA · 2 rRNA

ND5ND1ND3ND2COX2ND4ND6CYTBCOX3COX1ND4LATP8ATP6rrn12rrn16

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anthopleura xanthogrammica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈290 039 430 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthopleura xanthogrammica0.29 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.3% BUSCO

08Occurrence & distribution

Record type33 173 records

Wild obs. + sensor32 968

Museum / vouchered114

Other91

Range

Area of Occupancy AOO6 796 km²

Depth

0–200 m sunlit8 016

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5.7 m · max 21.6 m · 8 016 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 10 224≤1 km 18 264≤10 km 881>10 km 475

29 844 georeferenced · 3 124 without coordinates

Open the mapobservation + sensor32 968

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 2≤10 km 7>10 km 2

11 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	53
Victoria, CA	13
Cambridge, US	7
CASlocation not on record	5
Washington, US	5
National Institute of Biological Resourceslocation not on record	4
Montgomery, US	4
Toronto, CA	3
	2
Centre for Biodiversity Genomicslocation not on record	2
Florida Museum of Natural Historylocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Royal British Columbia Museumlocation not on record	1
MZLUlocation not on record	1

14 institutions · 102 of 114 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Anthopleura xanthogrammica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthopleura xanthogrammica

At a glance

Sources13 archives

Size & morphology1

Habitat & environment2

Other traits2

Compound class profile5 classes

Documented compounds76 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type33 173 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type33 173 records