Anemonia alicemartinae

Häussermann & Försterra, 2001 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Actiniaria/Actiniidae/Anemonia

At a glance

Occurrence records670

Data sources7

Biological traits2

DNA specimens19

eDNA detections21

Sources7 archives

Databases and archives Anemonia alicemartinae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility541 records↗

OBISOcean Biodiversity Information System129 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS670 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD19 specimens

01Narrative

Anemonia alicemartinae is een zeeanemonensoort uit de familie Actiniidae. Anemonia alicemartinae is voor het eerst wetenschappelijk beschreven door Haeussermann & Foersterra in 2001.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemonia alicemartinae has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections21

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P612 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

4Gmostly conserved

34Amostly conserved

169Cmostly conserved

213Amostly conserved

253Cmostly conserved

308Cmostly conserved

431Cmostly conserved

AAAGATATTGGAACTTTATATTTAGTGTTTGGAATAGGGTCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAACTATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes16

BIN1

Most divergent pair1.1%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Urticinopsis antarcticasame family3.0%Stichodactyla haddonisame order3.0%Actinia equinasame family3.0%Anthopleura xanthogrammicasame family3.2%Bolocera tuediaesame family3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type670 records

Wild obs. + sensor615

Museum / vouchered5

Other50

Range

Area of Occupancy AOO488 km²

Depth

0–200 m sunlit54

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 25 m · 54 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 315≤1 km 70≤10 km 50>10 km 10

445 georeferenced · 170 without coordinates

Open the mapobservation + sensor615

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo de Zoología de la Universidad de Concepción (UCCC_MZUC)location not on record	1
WoRMS Editorial Boardlocation not on record	1
Washington, US	1

3 institutions · 3 of 5 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Anemonia alicemartinae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 21.5–21.5

Seasonal swing summer↔winter7.30 °C

Max temp (day)23.1 °C

Min temp (night)20.4 °C

Precipitation126 mm/mo

Air humidity58.1 %

Vapour deficit1,070 Pa

Cloud cover34.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)