Anthopleura sola

Pearse & Francis, 2000 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Actiniaria/Actiniidae/Anthopleura

At a glance

Occurrence records205 108

Data sources12

Biological traits5

DNA specimens23

eDNA detections2

Sources12 archives

Databases and archives Anthopleura sola's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility110 104 records↗

OBISOcean Biodiversity Information System95 004 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS205 108 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceGoaT · NCBI≈300 Mbp

01Narrative

In a California tide pool, Anthopleura sola fight for territory using their white stinging acrorhagi. The starburst anemone or sunburst anemone (Anthopleura sola) is a species of sea anemone in the family Actiniidae. The sunburst anemone was formerly considered the solitary form of the common aggregating anemone, but was identified as a separate species in 2000.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length6 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max18 m

Depth min0 m

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthopleura sola has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

4Tmostly conserved

28Amostly conserved

214Tmostly conserved

216Gmostly conserved

628Tmostly conserved

AACTTTATATTTAGTGTTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAGTTGTCTGCCCCTGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stichodactyla haddonisame order3.2%Anemonia alicemartinaesame family3.3%Urticinopsis antarcticasame family3.8%Aulactinia marplatensissame family4.0%Bolocera tuediaesame family4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anthopleura sola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈299 691 816 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthopleura sola0.30 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness4.3% BUSCO

08Occurrence & distribution

Record type205 108 records

Wild obs. + sensor205 048

Museum / vouchered60

Range

Area of Occupancy AOO4 796 km²

Depth

0–200 m sunlit88 738

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 8.5 m · max 24.5 m · 88 738 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 13 431≤1 km 186 803≤10 km 1 096>10 km 561

201 891 georeferenced · 3 157 without coordinates

Open the mapobservation + sensor205 048

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	27
CASlocation not on record	5
Santa Barbara Museum of Natural Historylocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Los Angeles, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
WoRMS Editorial Boardlocation not on record	1

7 institutions · 41 of 60 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Anthopleura sola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

intertidal zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter5.50 °C

Max temp (day)17.7 °C

Min temp (night)12.1 °C

Precipitation59.6 mm/mo

Air humidity61.0 %

Moisture balance-17.4 mm/mo

Vapour deficit642 Pa

Wind speed3.90 m/s

Cloud cover41.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthopleura sola

At a glance

Sources12 archives

Size & morphology1

Habitat & environment2

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type205 108 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type205 108 records