Anthopleura elegantissima

(Brandt, 1835) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Actiniaria/Actiniidae/Anthopleura

At a glance

Occurrence records23 097

Data sources13

Biological traits3

DNA specimens177

eDNA detections284

Sources13 archives

Databases and archives Anthopleura elegantissima's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 686 records↗

OBISOcean Biodiversity Information System1 411 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI284 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics177 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Chemical compositionLOTUS · NPASS19 compounds

Occurrence & distributionGBIF · OBIS23 097 records

Environmental DNA4 datasets · 2 countries284 detections

DNA & barcodingBOLD177 specimens

Genome at a glanceGoaT · NCBI≈323 Mbp

01Narrative

The aggregating anemone (Anthopleura elegantissima), or clonal anemone, is the most abundant species of sea anemone found on rocky, tide swept shores along the Pacific coast of North America.Kozloff, Eugene N.. Marine Invertebrates of the Pacific Northwest. 2nd. Seattle: University of Washington Press, 1996. This cnidarian hosts endosymbiotic algae called zooxanthellae that contribute substantially to primary productivity in the intertidal zone.Fitt, W. K., R. L. Pardy, AND M. M. Luttker. 1982. Photosynthesis, respiration, and contribution to community productivity of the symbiotic sea anemone Anthopleura elegantissima. J. Exp. Mar. Biol. Ecol. 61: 213–232. The aggregating anemone has become a model organism for the study of temperate cnidarian-algal symbioses.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length8 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition19 compounds

Compounds documented for Anthopleura elegantissima across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Mycosporine and Mycosporine-like amino acids3

Wax monoesters2

Tripeptides2

Fatty alcohols2

Unsaturated fatty acids2

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,8R,9R,10S,13R,14R,17S)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8S,9R,10R,13S,14S,17S)-17-[(2R,5R)-5,6-dimethylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
3-Phenyllactyl-leucyl-arginyl-asparaginamide	present	LOTUS
3-Phenyllactyl-phenylalanyl-lysyl-alaninamide	present	LOTUS
6-methoxy-3-(1,3-thiazol-2-yl)-1H-indole	present	NPASS
Alpha-Amyrin	present	NPASS
beta-Amyrin	present	NPASS
BULCNSNGNSSTBP-INIZCTEOSA-N	present	NPASS
Camalexin	present	NPASS
cis-11-Eicosenoic acid methyl ester	present	NPASS

05DNA & barcoding177 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthopleura elegantissima has left across the world's sequence archives.

At a glance

DNA specimens177

BINs5

Marker genes3

eDNA detections284

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus114 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

13Amostly conserved

14Gmostly conserved

16Gmostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

23Amostly conserved

24Tmostly conserved

26Gmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Cmostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

37Gmostly conserved

38Amostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Cmostly conserved

44Amostly conserved

46Amostly conserved

47Gmostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

51Tmostly conserved

52Amostly conserved

54Gmostly conserved

55Tmostly conserved

56Amostly conserved

58Gmostly conserved

59Tmostly conserved

63Tmostly conserved

65Amostly conserved

66Gmostly conserved

67Amostly conserved

68Tmostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

73Gmostly conserved

76Gmostly conserved

88Tmostly conserved

103Tmostly conserved

202Gmostly conserved

274Cmostly conserved

325Cmostly conserved

355Cmostly conserved

373Cmostly conserved

571Amostly conserved

AACTTTATATTTAGTGTTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAGTTGTCTGCCCCTGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes3

BINs5

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stichodactyla haddonisame order3.2%Anemonia alicemartinaesame family3.3%Urticinopsis antarcticasame family3.8%Aulactinia marplatensissame family4.0%Bolocera tuediaesame family4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS18S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anthopleura elegantissima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈322 909 585 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthopleura elegantissima0.32 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type23 097 records

Wild obs. + sensor22 341

Museum / vouchered698

Other58

Range

Area of Occupancy AOO8 760 km²

Depth

0–200 m sunlit1 161

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.3 m · max 24.5 m · 1 161 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 12 521≤1 km 4 443≤10 km 885>10 km 466

18 315 georeferenced · 4 026 without coordinates

Open the mapobservation + sensor22 341

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 2≤1 km 28≤10 km 34>10 km 4

68 georeferenced · 630 without coordinates

Open the institutions mapphysical evidence698

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	157
Stanford Universitylocation not on record	123
Santa Barbara Museum of Natural Historylocation not on record	66
CASlocation not on record	29
Cambridge, US	27
Victoria, CA	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	13
Smithsonian Institution, National Museum of Natural Historylocation not on record	11
National Institute of Biological Resourceslocation not on record	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Centre for Biodiversity Genomicslocation not on record	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
	2
Toronto, CA	2
Royal British Columbia Museumlocation not on record	2
Florida Museum of Natural Historylocation not on record	1
Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoologylocation not on record	1
Los Angeles, US	1

18 institutions · 476 of 698 vouchered records shown · 34 without an institution code

09Environmental DNA284 detections

Where the DNA of Anthopleura elegantissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found284

Studies independent surveys4

Countries2

Verifiable raw sequence linked275

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 284 detections have coordinates

Open the map2 countries0

Intertidal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C -2.80–17.1

Seasonal swing summer↔winter22.7 °C

Max temp (day)13.1 °C 0.9–20.2

Min temp (night)8.50 °C -6.10–15.0

Precipitation130 mm/mo 94.3–130

Air humidity63.7 % 60.3–63.7

Moisture balance66.1 mm/mo -35.9–89.6

Vapour deficit464 Pa 197–679

Wind speed4.20 m/s 4.10–5.90

Cloud cover54.6 % 48.7–59.4

CHELSA 1981–2010, ~9 km grid, at location & month of 276 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthopleura elegantissima

At a glance

Sources13 archives

Size & morphology1

Habitat & environment2

Compound class profile5 classes

Documented compounds19 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type23 097 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type23 097 records